SNIP1-Smad nuclear interacting protein 1 Gene View larger

SNIP1-Smad nuclear interacting protein 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SNIP1-Smad nuclear interacting protein 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SNIP1-Smad nuclear interacting protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC027040
Product type: DNA & cDNA
Ncbi symbol: SNIP1
Origin species: Human
Product name: SNIP1-Smad nuclear interacting protein 1 Gene
Size: 2ug
Accessions: BC027040
Gene id: 79753
Gene description: Smad nuclear interacting protein 1
Synonyms: FHA domain-containing protein SNIP1; PMRED; smad nuclear-interacting protein 1; Smad nuclear interacting protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaggcggtgaagagcgaacgggagcgagggagccggcgaagacaccgggacggggacgtggtgctgccggcgggggtggtagtgaagcaggagcgtctcagcccagaagtcgcacctcccgcccaccgccgtccggaccactccggtggtagcccgtctccgccgaccagcgagccggcccgctcgggccaccgcgggaaccgagcccgaggagttagccggtccccacccaaaaagaaaaacaaggcctcagggagaagaagcaagtctcctcgcagtaagagaaaccgaagtcctcaccactcaacagtcaaagtgaagcaggagcgtgaggatcatccccggagaggacgggaggatcggcagcacagggaaccatcagaacaggaacacaggagagctaggaacagtgaccgggacagacaccggggccattcccaccaaaggagaacgtctaacgagaggcctgggagtgggcagggtcagggacgggatcgagacactcagaacctgcaggctcaggaagaagagcgggagttttataatgccaggcgacgggagcatcgccagaggaatgacgttggtggtggcggcagtgagtctcaggagttggttcctcggcctggtggcaacaacaaagaaaaagaggtgcccgctaaagaaaaaccaagctttgaactttctggggcacttcttgaggacaccaacactttccggggtgtagtcattaaatatagtgagcccccagaagcacgtatccccaaaaaacggtggcgtctctacccatttaaaaatgatgaggtgcttccagtcatgtacatacatcgacagagtgcgtacctactgggtcgacaccgccgcattgcagacattccaattgatcacccgtcttgttcaaagcagcatgcggtctttcaatatcggcttgtggaatatacccgtgctgatggcacagttggccgaagagtgaagccctacatcattgaccttggctcaggcaatggaaccttcttaaacaacaaacgtattgagccacagagatactatgaactaaaagaaaaggatgtactcaaatttggattcagtagcagagaatacgtcttgctccatgagtcgtcggacacttctgaaatagacaggaaagatgacgaggatgaggaggaggaggaagaagtgtctgacagctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - sphingosine-1-phosphate receptor 5
- indoleamine-pyrrole 2,3 dioxygenase
- WD repeat and SOCS box-containing 2
- STE20-related kinase adaptor beta

Buy SNIP1-Smad nuclear interacting protein 1 Gene now

Add to cart