Login to display prices
Login to display prices
TGFB1-transforming growth factor, beta 1 Gene View larger

TGFB1-transforming growth factor, beta 1 Gene

PTXBC000125

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TGFB1-transforming growth factor, beta 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TGFB1-transforming growth factor, beta 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000125
Product type: DNA & cDNA
Ncbi symbol: TGFB1
Origin species: Human
Product name: TGFB1-transforming growth factor, beta 1 Gene
Size: 2ug
Accessions: BC000125
Gene id: 7040
Gene description: transforming growth factor, beta 1
Synonyms: CED; DPD1; LAP; TGFB; TGFbeta; transforming growth factor beta-1; TGF-beta-1; latency-associated peptide; prepro-transforming growth factor beta-1; transforming growth factor beta 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgccctccgggctgcggctgctgctgctgctgctaccgctgctgtggctactggtgctgacgcctggccggccggccgcgggactatccacctgcaagactatcgacatggagctggtgaagcggaagcgcatcgaggccatccgcggccagatcctgtccaagctgcggctcgccagccccccgagccagggggaggtgccgcccggcccgctgcccgaggccgtgctcgccctgtacaacagcacccgcgaccgggtggccggggagagtgcagaaccggagcccgagcctgaggccgactactacgccaaggaggtcacccgcgtgctaatggtggaaacccacaacgaaatctatgacaagttcaagcagagtacacacagcatatatatgttcttcaacacatcagagctccgagaagcggtacctgaacccgtgttgctctcccgggcagagctgcgtctgctgaggctcaagttaaaagtggagcagcacgtggagctgtaccagaaatacagcaacaattcctggcgatacctcagcaaccggctgctggcacccagcgactcgccagagtggttatcttttgatgtcaccggagttgtgcggcagtggttgagccgtggaggggaaattgagggctttcgccttagcgcccactgctcctgtgacagcagggataacacactgcaagtggacatcaacgggttcactaccggccgccgaggtgacctggccaccattcatggcatgaaccggcctttcctgcttctcatggccaccccgctggagagggcccagcatctgcaaagctcccggcaccgccgagccctggacaccaactattgcttcagctccacggagaagaactgctgcgtgcggcagctgtacattgacttccgcaaggacctcggctggaagtggatccacgagcccaagggctaccatgccaacttctgcctcgggccctgcccctacatttggagcctggacacgcagtacagcaaggtcctggccctgtacaaccagcataacccgggcgcctcggcggcgccgtgctgcgtgccgcaggcgctggagccgctgcccatcgtgtactacgtgggccgcaagcccaaggtggagcagctgtccaacatgatcgtgcgctcctgcaagtgcagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RNA binding motif protein, X-linked
- Smad nuclear interacting protein 1
- sphingosine-1-phosphate receptor 5
- indoleamine-pyrrole 2,3 dioxygenase