PTXBC018453
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018453 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MITD1 |
| Origin species: | Human |
| Product name: | MITD1-MIT, microtubule interacting and transport, domain containing 1 Gene |
| Size: | 2ug |
| Accessions: | BC018453 |
| Gene id: | 129531 |
| Gene description: | MIT, microtubule interacting and transport, domain containing 1 |
| Synonyms: | MIT domain-containing protein 1; MIT, microtubule interacting and transport, domain containing 1; microtubule interacting and trafficking domain containing 1 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgaagtccgggctgaggcaggacccgcagagcacagctgcagccactgtgctaaagcgggcagtagaactagattcggagtcgcggtatccgcaggctctggtgtgttaccaagaggggattgatctgctcctgcaggttctgaaaggtaccaaagataatactaagagatgtaatctcagagaaaaaatttccaaatacatggacagagcggaaaacataaagaagtacttggaccaagaaaaagaagatggaaaatatcacaagcaaattaaaatagaagagaatgcaacaggtttcagttatgagtcactttttcgcgaataccttaatgagacagttacagaagtttggatagaagatccttatattagacatactcatcagctgtataactttcttcgattttgtgagatgcttattaagagaccatgtaaagtaaaaactattcaccttctcacctctctggatgaaggcattgagcaagtgcagcaaagtagaggcctgcaagaaatagaagagtcactcaggagtcacggagtgctgttggaagttcaatactcttcttcaatacatgaccgagaaattaggttcaacaatggatggatgattaagattggaaggggacttgattattttaagaaaccacagagtcgtttttcccttggatattgtgattttgatttaagaccatgtcatgaaacaacagtagacatttttcataagaagcatacaaaaaatatatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 - tumor necrosis factor receptor superfamily, member 6b, decoy - vesicle amine transport protein 1 homolog (T. californica)-like - translocase of inner mitochondrial membrane 44 homolog (yeast) |