Login to display prices
Login to display prices
MITD1-MIT, microtubule interacting and transport, domain containing 1 Gene View larger

MITD1-MIT, microtubule interacting and transport, domain containing 1 Gene

PTXBC018453

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MITD1-MIT, microtubule interacting and transport, domain containing 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MITD1-MIT, microtubule interacting and transport, domain containing 1 Gene

Proteogenix catalog: PTXBC018453
Ncbi symbol: MITD1
Product name: MITD1-MIT, microtubule interacting and transport, domain containing 1 Gene
Size: 2ug
Accessions: BC018453
Gene id: 129531
Gene description: MIT, microtubule interacting and transport, domain containing 1
Synonyms: MIT domain-containing protein 1; MIT, microtubule interacting and transport, domain containing 1; microtubule interacting and trafficking domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgaagtccgggctgaggcaggacccgcagagcacagctgcagccactgtgctaaagcgggcagtagaactagattcggagtcgcggtatccgcaggctctggtgtgttaccaagaggggattgatctgctcctgcaggttctgaaaggtaccaaagataatactaagagatgtaatctcagagaaaaaatttccaaatacatggacagagcggaaaacataaagaagtacttggaccaagaaaaagaagatggaaaatatcacaagcaaattaaaatagaagagaatgcaacaggtttcagttatgagtcactttttcgcgaataccttaatgagacagttacagaagtttggatagaagatccttatattagacatactcatcagctgtataactttcttcgattttgtgagatgcttattaagagaccatgtaaagtaaaaactattcaccttctcacctctctggatgaaggcattgagcaagtgcagcaaagtagaggcctgcaagaaatagaagagtcactcaggagtcacggagtgctgttggaagttcaatactcttcttcaatacatgaccgagaaattaggttcaacaatggatggatgattaagattggaaggggacttgattattttaagaaaccacagagtcgtttttcccttggatattgtgattttgatttaagaccatgtcatgaaacaacagtagacatttttcataagaagcatacaaaaaatatatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: