MITD1-MIT, microtubule interacting and transport, domain containing 1 Gene View larger

MITD1-MIT, microtubule interacting and transport, domain containing 1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MITD1-MIT, microtubule interacting and transport, domain containing 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MITD1-MIT, microtubule interacting and transport, domain containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018453
Product type: DNA & cDNA
Ncbi symbol: MITD1
Origin species: Human
Product name: MITD1-MIT, microtubule interacting and transport, domain containing 1 Gene
Size: 2ug
Accessions: BC018453
Gene id: 129531
Gene description: MIT, microtubule interacting and transport, domain containing 1
Synonyms: MIT domain-containing protein 1; MIT, microtubule interacting and transport, domain containing 1; microtubule interacting and trafficking domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgaagtccgggctgaggcaggacccgcagagcacagctgcagccactgtgctaaagcgggcagtagaactagattcggagtcgcggtatccgcaggctctggtgtgttaccaagaggggattgatctgctcctgcaggttctgaaaggtaccaaagataatactaagagatgtaatctcagagaaaaaatttccaaatacatggacagagcggaaaacataaagaagtacttggaccaagaaaaagaagatggaaaatatcacaagcaaattaaaatagaagagaatgcaacaggtttcagttatgagtcactttttcgcgaataccttaatgagacagttacagaagtttggatagaagatccttatattagacatactcatcagctgtataactttcttcgattttgtgagatgcttattaagagaccatgtaaagtaaaaactattcaccttctcacctctctggatgaaggcattgagcaagtgcagcaaagtagaggcctgcaagaaatagaagagtcactcaggagtcacggagtgctgttggaagttcaatactcttcttcaatacatgaccgagaaattaggttcaacaatggatggatgattaagattggaaggggacttgattattttaagaaaccacagagtcgtttttcccttggatattgtgattttgatttaagaccatgtcatgaaacaacagtagacatttttcataagaagcatacaaaaaatatatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1
- tumor necrosis factor receptor superfamily, member 6b, decoy
- vesicle amine transport protein 1 homolog (T. californica)-like
- translocase of inner mitochondrial membrane 44 homolog (yeast)

Buy MITD1-MIT, microtubule interacting and transport, domain containing 1 Gene now

Add to cart