Cart 3 Product Products 348,30 € (empty)
-
1 x HNRNPA0-he...121,50 € -
1 x VASH2-vaso...113,40 € -
1 x HIST1H4L-h...113,40 €
No products
To be determined Shipping
348,30 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 348,30 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 348,30 €
View larger 
TIMM44-translocase of inner mitochondrial membrane 44 homolog (yeast) Gene
PTXBC033628
New product
Data sheet of TIMM44-translocase of inner mitochondrial membrane 44 homolog (yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TIMM44-translocase of inner mitochondrial membrane 44 homolog (yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC033628 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TIMM44 |
| Origin species: | Human |
| Product name: | TIMM44-translocase of inner mitochondrial membrane 44 homolog (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC033628 |
| Gene id: | 10469 |
| Gene description: | translocase of inner mitochondrial membrane 44 homolog (yeast) |
| Synonyms: | TIM44; mitochondrial import inner membrane translocase subunit TIM44; translocase of inner mitochondrial membrane 44 homolog; translocase of inner mitochondrial membrane 44 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcggcggccctgcggagtggctggtgccgctgtccacggagatgcctcggcagtggaatccaatttctttccagccacaacctaccccatgggtcgacctatcagatgcgccggccgggcggagagctgccactgtccaaatcatattcttctggaaacagaaaaggctttctgtccggcttgctagataatgtcaaacaagaattagccaaaaacaaagaaatgaaagaaagtataaaaaaattccgtgacgaggccagaaggctagaagaatcagacgtgctccaggaggccagaaggaaatacaaaaccatcgagtcagaaaccgtgcggacgagcgaggtgctacggaagaagcttggggagctgacgggcaccgtgaaggagagccttcacgaagtcagtaaaagtgatctcggccggaaaatcaaggagggcgtggaggaagcagccaagacggccaagcagtcggccgagtcggtatccaaaggcggggagaagctgggcaggacagcggccttcagagccctctcccagggggtggagtccgtgaagaaggaaattgacgacagcgtcctgggacagaccgggccctaccggaggccccagcgactccggaagagaacggagtttgcgggagataagttcaaggaggagaaagtgtttgagccaaacgaggaggccctgggggtcgtgctgcacaaggactccaagtggtaccagcagtggaaggacttcaaggagaacaacgtggtgtttaaccggttcttcgagatgaagatgaagtatgacgaaagcgacaacgcgttcatccgggcatcccgggcccttacggacaaggtcaccgacttgctggggggcctgttctccaagacagagatgtcggaggtgctcacggagatcctccgggtggacccggcctttgacaaggaccggtttctgaaacagtgcgagaacgacatcatccccaatgtcctggaggccatgatttctggagagcttgacattctcaaagactggtgctatgaagctacttacagccagctggcccaccccatccagcaggccaaggcactgggtctccagttccattctcgcatcctagacattgacaacgtcgacctggccatgggcaagatgatggagcaggggccggtgctgatcatcaccttccaggcacagctggtgatggtggtcaggaaccccaaaggcgaggtggtggagggtgacccggacaaggtgctgcggatgctgtacgtgtgggcgctctgccgagaccaggacgagctcaacccctacgcggcctggcggctcctggacatctcggcctccagcaccgagcagattctctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - amyloid beta (A4) precursor protein-binding, family B, member 3 - transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila) - UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast) - fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae) |