APBB3-amyloid beta (A4) precursor protein-binding, family B, member 3 Gene View larger

APBB3-amyloid beta (A4) precursor protein-binding, family B, member 3 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of APBB3-amyloid beta (A4) precursor protein-binding, family B, member 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about APBB3-amyloid beta (A4) precursor protein-binding, family B, member 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013158
Product type: DNA & cDNA
Ncbi symbol: APBB3
Origin species: Human
Product name: APBB3-amyloid beta (A4) precursor protein-binding, family B, member 3 Gene
Size: 2ug
Accessions: BC013158
Gene id: 10307
Gene description: amyloid beta (A4) precursor protein-binding, family B, member 3
Synonyms: FE65L2; SRA; amyloid beta A4 precursor protein-binding family B member 3; FE65-like protein 2; amyloid beta (A4) precursor protein-binding, family B, member 3; amyloid precursor interacting protein; protein Fe65-like 2; amyloid beta precursor protein binding family B member 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgggcaaggattacatgctggccatcattctggtcaactgcgatgatgacttgtggggggaccacagtctggaggtggaggctggcctgcctcctggctggaggaagatccacgatgctgcaggtacttactactggcatgtacccagcggtagcacccagtggcagcgcccaacctgggaactaggagatgcagaggacccaggcacgggaacggaggggatctggggactgcggccccccaaagggagatccttctccagcctggagagttcactggaccggagtaactctctgtcctggtatggtggggaatcctacatccagagcatggagccaggggctaagtgctttgcagtccgctctctgggctgggtagaggtacctgaagaggacctggcaccggggaagagcagtattgcagtcaataactgtatccagcagctggcccagacccgcagccggagccagcctccagatggtgcctggggtgagggccagaacatgctgatgatcctgaagaaggatgccatgagcctagtgaatcccctggaccacagtctgatccactgccagcctctggtgcacatccgtgtgtggggcgtggggagctccaagggccgtgacagggacttcgcttttgtggcaagtgacaaagatagctgtatgctcaagtgccatgtgtttcgctgtgatgtccctgccaaggccattgccagtgccctacatgggctttgtgcccagatcttgtcagagcgagtagaggtcagtggtgatgcctcttgctgctccccagaccccatctctcctgaagacctgccacggcaagtggagctgctggatgcggtaagccaagctgctcagaagtacgaggcactgtatatggggacactgccagtcaccaaggccatgggcatggatgtgctgaacgaggccattggtaccctcaccgccaggggggaccggaatgcctgggtccccaccatgctcagtgtgtctgactctctcatgactgcacaccccattcaggcagaggccagtacagaggaggagccattgtggcagtgccctgtgcgccttgtgacatttattggtgttggccgcgacccacacacctttggcctcatcgctgacctgggccgtcagagcttccagtgcgcagccttctggtgccagccccatgcagggggactctctgaagctgtgcaggctgcctgtatggttcagtaccagaagtgtcttgtggcctctgcagctcgaggcaaggcctggggtgcccaggcccgtgcccgcctgcggctcaagcggaccagctccatggattccccaggaggtcccctgcccctccccctgctcaaaggaggggttggcggtgcaggggcaacccctcgaaagcggggtgtcttctctcttcttgatgccttccggctgaaaccctctctgctccatatgccctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)
- UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)
- fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae)
- ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase)

Buy APBB3-amyloid beta (A4) precursor protein-binding, family B, member 3 Gene now

Add to cart