Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
APBB3-amyloid beta (A4) precursor protein-binding, family B, member 3 Gene
PTXBC013158
New product
Data sheet of APBB3-amyloid beta (A4) precursor protein-binding, family B, member 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about APBB3-amyloid beta (A4) precursor protein-binding, family B, member 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013158 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | APBB3 |
| Origin species: | Human |
| Product name: | APBB3-amyloid beta (A4) precursor protein-binding, family B, member 3 Gene |
| Size: | 2ug |
| Accessions: | BC013158 |
| Gene id: | 10307 |
| Gene description: | amyloid beta (A4) precursor protein-binding, family B, member 3 |
| Synonyms: | FE65L2; SRA; amyloid beta A4 precursor protein-binding family B member 3; FE65-like protein 2; amyloid beta (A4) precursor protein-binding, family B, member 3; amyloid precursor interacting protein; protein Fe65-like 2; amyloid beta precursor protein binding family B member 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgggcaaggattacatgctggccatcattctggtcaactgcgatgatgacttgtggggggaccacagtctggaggtggaggctggcctgcctcctggctggaggaagatccacgatgctgcaggtacttactactggcatgtacccagcggtagcacccagtggcagcgcccaacctgggaactaggagatgcagaggacccaggcacgggaacggaggggatctggggactgcggccccccaaagggagatccttctccagcctggagagttcactggaccggagtaactctctgtcctggtatggtggggaatcctacatccagagcatggagccaggggctaagtgctttgcagtccgctctctgggctgggtagaggtacctgaagaggacctggcaccggggaagagcagtattgcagtcaataactgtatccagcagctggcccagacccgcagccggagccagcctccagatggtgcctggggtgagggccagaacatgctgatgatcctgaagaaggatgccatgagcctagtgaatcccctggaccacagtctgatccactgccagcctctggtgcacatccgtgtgtggggcgtggggagctccaagggccgtgacagggacttcgcttttgtggcaagtgacaaagatagctgtatgctcaagtgccatgtgtttcgctgtgatgtccctgccaaggccattgccagtgccctacatgggctttgtgcccagatcttgtcagagcgagtagaggtcagtggtgatgcctcttgctgctccccagaccccatctctcctgaagacctgccacggcaagtggagctgctggatgcggtaagccaagctgctcagaagtacgaggcactgtatatggggacactgccagtcaccaaggccatgggcatggatgtgctgaacgaggccattggtaccctcaccgccaggggggaccggaatgcctgggtccccaccatgctcagtgtgtctgactctctcatgactgcacaccccattcaggcagaggccagtacagaggaggagccattgtggcagtgccctgtgcgccttgtgacatttattggtgttggccgcgacccacacacctttggcctcatcgctgacctgggccgtcagagcttccagtgcgcagccttctggtgccagccccatgcagggggactctctgaagctgtgcaggctgcctgtatggttcagtaccagaagtgtcttgtggcctctgcagctcgaggcaaggcctggggtgcccaggcccgtgcccgcctgcggctcaagcggaccagctccatggattccccaggaggtcccctgcccctccccctgctcaaaggaggggttggcggtgcaggggcaacccctcgaaagcggggtgtcttctctcttcttgatgccttccggctgaaaccctctctgctccatatgccctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila) - UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast) - fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae) - ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase) |