Cart 8 Product Products 1 087,99 € (empty)
-
1 x HCCS-holoc...121,50 € -
1 x PTGER3-pro...121,50 € -
-
1 x NRN1-neuri...113,40 € -
1 x ABAT-4-ami...113,40 € -
1 x APBB3-amyl...121,50 € -
-
No products
To be determined Shipping
1 087,99 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 8 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 087,99 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 087,99 €
View larger 
USP14-ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase) Gene
PTXBC003556
New product
Data sheet of USP14-ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about USP14-ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003556 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | USP14 |
| Origin species: | Human |
| Product name: | USP14-ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase) Gene |
| Size: | 2ug |
| Accessions: | BC003556 |
| Gene id: | 9097 |
| Gene description: | ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase) |
| Synonyms: | TGT; ubiquitin carboxyl-terminal hydrolase 14; deubiquitinating enzyme 14; tRNA-guanine transglycosylase, 60-kD subunit; ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase); ubiquitin specific protease 14 (tRNA-guanine transglycosylase); ubiquitin thioesterase 14; ubiquitin thiolesterase 14; ubiquitin-specific processing protease 14; ubiquitin specific peptidase 14 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccgctctactccgttactgtaaaatggggaaaggagaaatttgaaggtgtagaattgaatacagatgaacctccaatggtattcaaggctcagctgtttgcgttgactggagtccagcctgccagacagaaagttatggtgaaaggaggaacgctaaaggatgatgattggggaaacatcaaaataaaaaatggaatgactctactaatgatggggtcagcagatgctcttccagaagaaccctcagccaaaactgtcttcgtagaagacatgacagaagaacagttagcatctgctatggagttaccatgtggattgacaaaccttggtaacacttgttacatgaatgccacagttcagtgtattcgttctgtgcctgaactcaaagatgcccttaaaaggtatgcaggtgccttgagagcttcaggggaaatggcttcagcgcagtatattactgcagcccttagagatttgtttgattccatggataaaacttcttccagtattccacctattattctactgcagtttttgcacatggctttcccacagtttgccgagaaaggtgaacaaggacagtatcttcaacaggatgctaatgaatgttggatacaaatgatgcgagtattgcaacagaaattggaagcaatagaggatgattctgttaaagagacagactcctcatctgcatcggcagcgacaccttctaaaaagaaaagtttaatcgatcagttcttcggtgttgagtttgaaactaccatgaaatgtacagaatctgaagaagaagaagtcaccaaaggaaaggaaaatcaacttcagcttagctgttttatcaatcaggaagtcaagtatctttttacaggacttaaattgcgacttcaggaagaaatcaccaaacagtctccaacgttgcaaagaaatgccttgtatatcaaatcttccaagatcagccggctgcctgcttacttgaccattcagatggttcgatttttttataaagagaaggaatctgtgaatgccaaagttcttaaggatgttaaatttcctcttatgttggatatgtatgaactgtgtacaccagaacttcaagagaaaatggtgtcttttcgatccaaattcaaggatctagaagataaaaaagtgaatcagcagccaaatacaagtgacaaaaagagtagtccccagaaagaagttaagtatgaacccttttcttttgctgatgatattggctccaataattgtggatactatgacttacaagcagtactaacacaccagggaaggtctagttcttcaggtcattatgtatcatgggtgaaaaggaaacaagatgaatggattaagtttgatgatgacaaagtcagcatcgtaacaccagaagatatcttacggctttctggtggtggagactggcatatcgcttacgttctactctatgggcctcgcagagttgaaataatggaagaggaaagtgaacagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila) - protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b - diazepam binding inhibitor (GABA receptor modulator, acyl-Coenzyme A binding protein) - potassium large conductance calcium-activated channel, subfamily M, alpha member 1 |