Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PTPLB-protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b Gene
PTXBC060839
New product
Data sheet of PTPLB-protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PTPLB-protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC060839 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PTPLB |
| Origin species: | Human |
| Product name: | PTPLB-protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b Gene |
| Size: | 2ug |
| Accessions: | BC060839 |
| Gene id: | 201562 |
| Gene description: | protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b |
| Synonyms: | PTPLB; very-long-chain (3R)-3-hydroxyacyl-CoA dehydratase 2; protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b; protein-tyrosine phosphatase-like member B; very-long-chain (3R)-3-hydroxyacyl-[acyl-carrier protein] dehydratase 2; 3-hydroxyacyl-CoA dehydratase 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcagtggcggcgactgcagcagcgaaggggaatgggggcggcggtggcagggccggggccggggacgccagcggcacgcggaagaagaagggcccggggcccctggccacggcgtacctggtcatctacaatgtggtgatgacagccgggtggctggttatagcggttggtctggtccgagcatacctggctaagggtagctaccatagcctttattattcaattgaaaagcctttgaaattctttcaaactggagccttattggagattttacattgtgctataggaattgttccatcttctgttgtcctgacttctttccaggtgatgtcaagagtttttctaatatgggcagtaacacatagcgtcaaagaggtacagagtgaagacagtgtcctcctgtttgttattgcatggacgatcacggaaatcatccgttactccttttatacattcagtctattaaaccatctgccttacctcatcaaatgggccaggtacacacttttcattgtgctgtacccaatgggagtgtcaggagaactgctcacaatatatgcagctctgccctttgtcagacaagctggcctatattccatcagtttacccaacaaatacaatttctcttttgactactatgcattcctgattctaataatgatctcctacattccaatttttccccagttatacttccacatgatacaccagagaagaaagatcctttctcatactgaagaacacaagaaatttgaatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - diazepam binding inhibitor (GABA receptor modulator, acyl-Coenzyme A binding protein) - potassium large conductance calcium-activated channel, subfamily M, alpha member 1 - colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) - colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) |