Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
KCNMA1-potassium large conductance calcium-activated channel, subfamily M, alpha member 1 Gene
PTXBC062659
New product
Data sheet of KCNMA1-potassium large conductance calcium-activated channel, subfamily M, alpha member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KCNMA1-potassium large conductance calcium-activated channel, subfamily M, alpha member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC062659 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KCNMA1 |
| Origin species: | Human |
| Product name: | KCNMA1-potassium large conductance calcium-activated channel, subfamily M, alpha member 1 Gene |
| Size: | 2ug |
| Accessions: | BC062659 |
| Gene id: | 3778 |
| Gene description: | potassium large conductance calcium-activated channel, subfamily M, alpha member 1 |
| Synonyms: | BKTM; KCa1.1; MaxiK; SAKCA; SLO; SLO-ALPHA; SLO1; bA205K10.1; hSlo; mSLO1; calcium-activated potassium channel subunit alpha-1; uncharacterized protein; BK channel alpha subunit; BKCA alpha subunit; big potassium channel alpha subunit; calcium-activated potassium channel, subfamily M subunit alpha-1; k(VCA)alpha; maxi-K channel HSLO; potassium channel, calcium activated large conductance subfamily M alpha, member 1; potassium large conductance calcium-activated channel, subfamily M, alpha member 1; slo homolog; slowpoke homolog; stretch-activated Kca channel; potassium calcium-activated channel subfamily M alpha 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcaaatggtggcggcggcggcggcggcagcagcggcggcggcggcggcggcggaggcagcagtcttagaatgagtagcaatatccacgcgaaccatctcagcctagacgcgtcctcctcctcctcctcctcctcttcctcttcttcttcttcctcctcctcttcctcctcgtcctcggtccacgagcccaagatggatgcgctcatcatcccggtgaccatggaggtgccgtgcgacagccggggccaacgcatgtggtgggctttcctggcctcctccatggtgactttcttcgggggcctcttcatcatcttgctctggcggacgctcaagtacctgtggaccgtgtgctgccactgcgggggcaagacgaaggccacccactttgggtccccggaaatgccaccagcagcgcggagctggagcgggagtccgcctgaggccgcggttttacgcggagcgtcttccctggcgctcgaggtggctagatgtcgtcggctttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) - colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) - solute carrier family 39 (metal ion transporter), member 11 - nuclear casein kinase and cyclin-dependent kinase substrate 1 |