Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SLC39A11-solute carrier family 39 (metal ion transporter), member 11 Gene
PTXBC035631
New product
Data sheet of SLC39A11-solute carrier family 39 (metal ion transporter), member 11 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC39A11-solute carrier family 39 (metal ion transporter), member 11 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC035631 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC39A11 |
| Origin species: | Human |
| Product name: | SLC39A11-solute carrier family 39 (metal ion transporter), member 11 Gene |
| Size: | 2ug |
| Accessions: | BC035631 |
| Gene id: | 201266 |
| Gene description: | solute carrier family 39 (metal ion transporter), member 11 |
| Synonyms: | C17orf26; ZIP11; zinc transporter ZIP11; ZIP-11; Zrt- and Irt-like protein 11; solute carrier family 39 (metal ion transporter), member 11; solute carrier family 39 member 11 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctccaaggccacagctctgtgttccaggccttgctggggaccttcttcacctgggggatgacagcagctggggcagctctcgtgttcgtattctctagtggacagaggcggatcttagatggaagtcttggctttgctgcaggggtcatgttggcagcttcctattggtctcttctggccccagcagttgagatggccacgtcctctgggggcttcggtgcctttgccttcttccctgtggctgttggcttcacccttggagcggcttttgtctacttggctgacctcctgatgcctcacttgggtgcagcagaagacccccagacggccctggcactgaacttcggctctacgttgatgaagaagaagtctgatcctgagggtcccgcgctgctcttccctgagagtgaactttccatccggatagacaagagtgagaatggtgaggcatatcagagaaagaaggcggcagccactggccttccagagggtcctgctgtccctgtgccttctcgagggaatctggcacagcccggcggcagcagctggaggaggatcgcactgctcatcttggccatcactatacacaacgttccagagggtctcgctgttggagttggatttggggctatagaaaagacggcatctgctacctttgagagtgccaggaatttggccattggaatcgggatccagaatttccccgagggcctggctgtcagccttcccttgcgaggggcaggcttctccacctggagagctttctggtatgggcagctgagcggcatggtggagcccctggccggggtctttggtgcctttgccgtggtgctggctgagcccatcctgccctacgctctggcctttgctgccggtgccatggtctacgtggtcatggacgacatcatccccgaagcccagatcagtggtaatgggaaactggcatcctgggcctccatcctgggatttgtagtgatgatgtcactggacgttggcctgggctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nuclear casein kinase and cyclin-dependent kinase substrate 1 - solute carrier family 23 (nucleobase transporters), member 1 - phosphoribosyl pyrophosphate synthetase-associated protein 1 - glutamate receptor, ionotropic, N-methyl D-aspartate-like 1A |