SLC39A11-solute carrier family 39 (metal ion transporter), member 11 Gene View larger

SLC39A11-solute carrier family 39 (metal ion transporter), member 11 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC39A11-solute carrier family 39 (metal ion transporter), member 11 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SLC39A11-solute carrier family 39 (metal ion transporter), member 11 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC035631
Product type: DNA & cDNA
Ncbi symbol: SLC39A11
Origin species: Human
Product name: SLC39A11-solute carrier family 39 (metal ion transporter), member 11 Gene
Size: 2ug
Accessions: BC035631
Gene id: 201266
Gene description: solute carrier family 39 (metal ion transporter), member 11
Synonyms: C17orf26; ZIP11; zinc transporter ZIP11; ZIP-11; Zrt- and Irt-like protein 11; solute carrier family 39 (metal ion transporter), member 11; solute carrier family 39 member 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctccaaggccacagctctgtgttccaggccttgctggggaccttcttcacctgggggatgacagcagctggggcagctctcgtgttcgtattctctagtggacagaggcggatcttagatggaagtcttggctttgctgcaggggtcatgttggcagcttcctattggtctcttctggccccagcagttgagatggccacgtcctctgggggcttcggtgcctttgccttcttccctgtggctgttggcttcacccttggagcggcttttgtctacttggctgacctcctgatgcctcacttgggtgcagcagaagacccccagacggccctggcactgaacttcggctctacgttgatgaagaagaagtctgatcctgagggtcccgcgctgctcttccctgagagtgaactttccatccggatagacaagagtgagaatggtgaggcatatcagagaaagaaggcggcagccactggccttccagagggtcctgctgtccctgtgccttctcgagggaatctggcacagcccggcggcagcagctggaggaggatcgcactgctcatcttggccatcactatacacaacgttccagagggtctcgctgttggagttggatttggggctatagaaaagacggcatctgctacctttgagagtgccaggaatttggccattggaatcgggatccagaatttccccgagggcctggctgtcagccttcccttgcgaggggcaggcttctccacctggagagctttctggtatgggcagctgagcggcatggtggagcccctggccggggtctttggtgcctttgccgtggtgctggctgagcccatcctgccctacgctctggcctttgctgccggtgccatggtctacgtggtcatggacgacatcatccccgaagcccagatcagtggtaatgggaaactggcatcctgggcctccatcctgggatttgtagtgatgatgtcactggacgttggcctgggctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nuclear casein kinase and cyclin-dependent kinase substrate 1
- solute carrier family 23 (nucleobase transporters), member 1
- phosphoribosyl pyrophosphate synthetase-associated protein 1
- glutamate receptor, ionotropic, N-methyl D-aspartate-like 1A

Buy SLC39A11-solute carrier family 39 (metal ion transporter), member 11 Gene now

Add to cart