Login to display prices
Login to display prices
SLC39A11-solute carrier family 39 (metal ion transporter), member 11 Gene View larger

SLC39A11-solute carrier family 39 (metal ion transporter), member 11 Gene

PTXBC035631

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC39A11-solute carrier family 39 (metal ion transporter), member 11 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLC39A11-solute carrier family 39 (metal ion transporter), member 11 Gene

Proteogenix catalog: PTXBC035631
Ncbi symbol: SLC39A11
Product name: SLC39A11-solute carrier family 39 (metal ion transporter), member 11 Gene
Size: 2ug
Accessions: BC035631
Gene id: 201266
Gene description: solute carrier family 39 (metal ion transporter), member 11
Synonyms: C17orf26; ZIP11; zinc transporter ZIP11; ZIP-11; Zrt- and Irt-like protein 11; solute carrier family 39 (metal ion transporter), member 11; solute carrier family 39 member 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctccaaggccacagctctgtgttccaggccttgctggggaccttcttcacctgggggatgacagcagctggggcagctctcgtgttcgtattctctagtggacagaggcggatcttagatggaagtcttggctttgctgcaggggtcatgttggcagcttcctattggtctcttctggccccagcagttgagatggccacgtcctctgggggcttcggtgcctttgccttcttccctgtggctgttggcttcacccttggagcggcttttgtctacttggctgacctcctgatgcctcacttgggtgcagcagaagacccccagacggccctggcactgaacttcggctctacgttgatgaagaagaagtctgatcctgagggtcccgcgctgctcttccctgagagtgaactttccatccggatagacaagagtgagaatggtgaggcatatcagagaaagaaggcggcagccactggccttccagagggtcctgctgtccctgtgccttctcgagggaatctggcacagcccggcggcagcagctggaggaggatcgcactgctcatcttggccatcactatacacaacgttccagagggtctcgctgttggagttggatttggggctatagaaaagacggcatctgctacctttgagagtgccaggaatttggccattggaatcgggatccagaatttccccgagggcctggctgtcagccttcccttgcgaggggcaggcttctccacctggagagctttctggtatgggcagctgagcggcatggtggagcccctggccggggtctttggtgcctttgccgtggtgctggctgagcccatcctgccctacgctctggcctttgctgccggtgccatggtctacgtggtcatggacgacatcatccccgaagcccagatcagtggtaatgggaaactggcatcctgggcctccatcctgggatttgtagtgatgatgtcactggacgttggcctgggctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: