Login to display prices
Login to display prices
NUCKS1-nuclear casein kinase and cyclin-dependent kinase substrate 1 Gene View larger

NUCKS1-nuclear casein kinase and cyclin-dependent kinase substrate 1 Gene

PTXBC000805

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NUCKS1-nuclear casein kinase and cyclin-dependent kinase substrate 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NUCKS1-nuclear casein kinase and cyclin-dependent kinase substrate 1 Gene

Proteogenix catalog: PTXBC000805
Ncbi symbol: NUCKS1
Product name: NUCKS1-nuclear casein kinase and cyclin-dependent kinase substrate 1 Gene
Size: 2ug
Accessions: BC000805
Gene id: 64710
Gene description: nuclear casein kinase and cyclin-dependent kinase substrate 1
Synonyms: JC7; nuclear ubiquitous casein and cyclin-dependent kinase substrate 1; nuclear ubiquitous casein kinase and cyclin-dependent kinase substrate; potential LAG1 interactor; nuclear casein kinase and cyclin dependent kinase substrate 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgcggcctgtcagaaataggaaggttgttgattactcacagtttcaggaatctgatgatgcagatgaagattatggaagagattcgggccctcccactaagaaaattcgatcatctccccgagaagctaaaaataagaggcgatctggaaagaattcacaggaagatagtgaggactcagaagacaaagatgtgaagaccaagaaggatgattctcactcagcagaggatagtgaagatgaaaaagaagatcataaaaatgtgcgccaacaacggcaggcggcatctaaagcagcttctaaacagagagagatgctcatggaagatgtgggcagtgaggaagaacaagaagaggaggatgaggcaccattccaggagaaagattccggcagcgatgaagatttcctaatggaagatgatgacgatagtgactatggcagttcgaaaaagaaaaacaaaaagatggttaagaagtccaaacctgaaagaaaagaaaagaaaatgcccaaacccagactaaaggctacagtgacgccaagtccagtgaaaggcaaagggaaagtgggtcgccccacagcttcaaaggcatcaaaggaaaagactccttctcccaaagaagaagatgaggaaccggaaagcccgccagaaaagaaaacatctacaagccccccacccgagaaatctggggatgaagggtctgaagatgaagccccttctggggaggattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: