Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NUCKS1-nuclear casein kinase and cyclin-dependent kinase substrate 1 Gene
PTXBC000805
New product
Data sheet of NUCKS1-nuclear casein kinase and cyclin-dependent kinase substrate 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NUCKS1-nuclear casein kinase and cyclin-dependent kinase substrate 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000805 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NUCKS1 |
| Origin species: | Human |
| Product name: | NUCKS1-nuclear casein kinase and cyclin-dependent kinase substrate 1 Gene |
| Size: | 2ug |
| Accessions: | BC000805 |
| Gene id: | 64710 |
| Gene description: | nuclear casein kinase and cyclin-dependent kinase substrate 1 |
| Synonyms: | JC7; nuclear ubiquitous casein and cyclin-dependent kinase substrate 1; nuclear ubiquitous casein kinase and cyclin-dependent kinase substrate; potential LAG1 interactor; nuclear casein kinase and cyclin dependent kinase substrate 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgcggcctgtcagaaataggaaggttgttgattactcacagtttcaggaatctgatgatgcagatgaagattatggaagagattcgggccctcccactaagaaaattcgatcatctccccgagaagctaaaaataagaggcgatctggaaagaattcacaggaagatagtgaggactcagaagacaaagatgtgaagaccaagaaggatgattctcactcagcagaggatagtgaagatgaaaaagaagatcataaaaatgtgcgccaacaacggcaggcggcatctaaagcagcttctaaacagagagagatgctcatggaagatgtgggcagtgaggaagaacaagaagaggaggatgaggcaccattccaggagaaagattccggcagcgatgaagatttcctaatggaagatgatgacgatagtgactatggcagttcgaaaaagaaaaacaaaaagatggttaagaagtccaaacctgaaagaaaagaaaagaaaatgcccaaacccagactaaaggctacagtgacgccaagtccagtgaaaggcaaagggaaagtgggtcgccccacagcttcaaaggcatcaaaggaaaagactccttctcccaaagaagaagatgaggaaccggaaagcccgccagaaaagaaaacatctacaagccccccacccgagaaatctggggatgaagggtctgaagatgaagccccttctggggaggattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 23 (nucleobase transporters), member 1 - phosphoribosyl pyrophosphate synthetase-associated protein 1 - glutamate receptor, ionotropic, N-methyl D-aspartate-like 1A - serum deprivation response (phosphatidylserine binding protein) |