SDPR-serum deprivation response (phosphatidylserine binding protein) Gene View larger

SDPR-serum deprivation response (phosphatidylserine binding protein) Gene

PTXBC016475

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SDPR-serum deprivation response (phosphatidylserine binding protein) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SDPR-serum deprivation response (phosphatidylserine binding protein) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016475
Product type: DNA & cDNA
Ncbi symbol: SDPR
Origin species: Human
Product name: SDPR-serum deprivation response (phosphatidylserine binding protein) Gene
Size: 2ug
Accessions: BC016475
Gene id: 8436
Gene description: serum deprivation response (phosphatidylserine binding protein)
Synonyms: CAVIN2; PS-p68; SDR; cavin-2; serum deprivation-response protein; phosphatidylserine-binding protein; serum deprivation response
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggagaggacgctgcacaggccgaaaagttccagcaccctgggtctgacatgcggcaggaaaagccctcgagccccagcccgatgccttcctccacaccaagccccagcctgaacctagggaacacagaggaggccatccgggacaactcacaggtgaacgcagtcacggtgctcacgctcctggacaagctggtgaacatgctagacgctgtgcaggagaaccagcacaagatggagcagcgacagatcagtttggagggctccgtgaagggcatccagaatgacctcaccaagctctccaagtaccaggcctccaccagcaacacggtgagcaagctgctggagaagtcccgcaaggtcagcgcccacacgcgcgcggtcaaagagcgcatggataggcagtgcgcacaggtgaagcggctggagaacaaccacgcccagctcctccgacgcaaccatttcaaagtgctcatcttccaggaggaaaatgagatccctgccagcgtgtttgtgaaacagcccgtttccggtgccgtggaagggaaggaggagcttccggatgaaaacaaatccctggaggaaaccctgcacaccgtggacctctcctcagatgatgatttgccccacgatgaggaggccctggaagacagtgccgaggaaaaggtggaagaaagtagggcagagaaaataaaaagatccagcctgaagaaagtggatagcctcaagaaagcattttctcgccagaacatcgagaaaaagatgaacaagctggggacaaagatcgtatctgtagagaggagagagaagattaagaaatctctcacgtcaaatcaccagaaaatatcctcaggaaaaagctcccccttcaaggtttctcccctcactttcgggcggaagaaagtccgagagggagaaagccatgcagaaaatgagaccaagtcagaagacctgcctagcagtgagcagatgccaaatgaccaggaagaggagtcctttgcagagggtcattccgaagcgtccctcgccagcgctctggtggaaggggaaattgcagaggaggctgctgagaaggcgacctccagggggagtaactcggggatggacagcaacatcgacttgactattgtggaagatgaagaggaggagtcagtggccctggaacaggcacagaaggtacgctatgagggtagctacgcgctaacatccgaggaggcggagcgctccgatggggaccccgtgcagcccgccgtgctccaggtgcaccagacctcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa
- general transcription factor IIIC, polypeptide 6, alpha 35kDa
- KRR1, small subunit (SSU) processome component, homolog (yeast)
- general transcription factor IIIC, polypeptide 2, beta 110kDa

Buy SDPR-serum deprivation response (phosphatidylserine binding protein) Gene now

Add to cart