KRR1-KRR1, small subunit (SSU) processome component, homolog (yeast) Gene View larger

KRR1-KRR1, small subunit (SSU) processome component, homolog (yeast) Gene

PTXBC016778

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KRR1-KRR1, small subunit (SSU) processome component, homolog (yeast) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KRR1-KRR1, small subunit (SSU) processome component, homolog (yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016778
Product type: DNA & cDNA
Ncbi symbol: KRR1
Origin species: Human
Product name: KRR1-KRR1, small subunit (SSU) processome component, homolog (yeast) Gene
Size: 2ug
Accessions: BC016778
Gene id: 11103
Gene description: KRR1, small subunit (SSU) processome component, homolog (yeast)
Synonyms: KRR1, small subunit processome component homolog; KRR1, small subunit (SSU) processome component, homolog; KRR1 small subunit processome component homolog; HRB2; RIP-1; HIV-1 Rev-binding protein 2; HIV-1 rev binding protein 2; KRR-R motif-containing protein 1; Rev interacting protein; rev-interacting protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgtctccctcgctggagcggccagaaaaaggcgctggaaaaagtgaatttcgtaaccagaagccgaagccggagaaccaagatgaatcagaactccttacggttcctgatggttggaaggaaccagctttttccaaagaggacaatcccagaggacttttggaggagagcagtttcgcaactttgttcccaaaatacaggggagcttacttgaaagagtgttggccattggtgcagaaagccttaaatgaacatcatgttaatgcaaccctggacctgatcgaaggcagcatgactgtttgtactacaaagaagacttttgatccatatatcatcattagggccagagatctgataaaactgttagcaaggagtgtttcatttgaacaggcagtacgaattcttcaggatgatgttgcatgtgacatcattaaaataggttctttagtaaggaataaagagagatttgtaaaacgaagacaacggcttattggtcccaaaggatctacattgaaggcattggaactcttaactaattgttacattatggttcagggaaacacagtttcagccattggaccttttagtggcttaaaagaggttagaaaagtagtccttgatactatgaagaatattcatccaatttataacattaaaagcttaatgattaagagagagttggcaaaagattctgaattacgatcacaaagttgggagagatttttgccacagttcaaacacaaaaatgtgaataaacgcaaggaaccaaagaaaaaaactgttaagaaagaatatacgccattcccaccaccacaaccagaaagtcagatcgataaagaattggctagtggtgaatactttttgaaggcaaatcagaagaagcggcagaaaatggaagcaataaaggctaaacaagcagaagccatcagtaagagacaagaggaaagaaacaaagcatttattccacctaaggaaaaaccaattgtgaaacctaaggaagcttctactgaaactaaaattgatgtggccagcatcaaggaaaaggttaagaaagcaaagaataagaaactgggagctcttacagctgaagaaattgcacttaagatggaggcagatgaaaagaaaaagaagaaaaaaaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - general transcription factor IIIC, polypeptide 2, beta 110kDa
- PTPRF interacting protein, binding protein 2 (liprin beta 2)
- ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4
- potassium inwardly-rectifying channel, subfamily J, member 13

Buy KRR1-KRR1, small subunit (SSU) processome component, homolog (yeast) Gene now

Add to cart