Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
KRR1-KRR1, small subunit (SSU) processome component, homolog (yeast) Gene
PTXBC016778
New product
Data sheet of KRR1-KRR1, small subunit (SSU) processome component, homolog (yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KRR1-KRR1, small subunit (SSU) processome component, homolog (yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016778 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KRR1 |
| Origin species: | Human |
| Product name: | KRR1-KRR1, small subunit (SSU) processome component, homolog (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC016778 |
| Gene id: | 11103 |
| Gene description: | KRR1, small subunit (SSU) processome component, homolog (yeast) |
| Synonyms: | KRR1, small subunit processome component homolog; KRR1, small subunit (SSU) processome component, homolog; KRR1 small subunit processome component homolog; HRB2; RIP-1; HIV-1 Rev-binding protein 2; HIV-1 rev binding protein 2; KRR-R motif-containing protein 1; Rev interacting protein; rev-interacting protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgtctccctcgctggagcggccagaaaaaggcgctggaaaaagtgaatttcgtaaccagaagccgaagccggagaaccaagatgaatcagaactccttacggttcctgatggttggaaggaaccagctttttccaaagaggacaatcccagaggacttttggaggagagcagtttcgcaactttgttcccaaaatacaggggagcttacttgaaagagtgttggccattggtgcagaaagccttaaatgaacatcatgttaatgcaaccctggacctgatcgaaggcagcatgactgtttgtactacaaagaagacttttgatccatatatcatcattagggccagagatctgataaaactgttagcaaggagtgtttcatttgaacaggcagtacgaattcttcaggatgatgttgcatgtgacatcattaaaataggttctttagtaaggaataaagagagatttgtaaaacgaagacaacggcttattggtcccaaaggatctacattgaaggcattggaactcttaactaattgttacattatggttcagggaaacacagtttcagccattggaccttttagtggcttaaaagaggttagaaaagtagtccttgatactatgaagaatattcatccaatttataacattaaaagcttaatgattaagagagagttggcaaaagattctgaattacgatcacaaagttgggagagatttttgccacagttcaaacacaaaaatgtgaataaacgcaaggaaccaaagaaaaaaactgttaagaaagaatatacgccattcccaccaccacaaccagaaagtcagatcgataaagaattggctagtggtgaatactttttgaaggcaaatcagaagaagcggcagaaaatggaagcaataaaggctaaacaagcagaagccatcagtaagagacaagaggaaagaaacaaagcatttattccacctaaggaaaaaccaattgtgaaacctaaggaagcttctactgaaactaaaattgatgtggccagcatcaaggaaaaggttaagaaagcaaagaataagaaactgggagctcttacagctgaagaaattgcacttaagatggaggcagatgaaaagaaaaagaagaaaaaaaagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - general transcription factor IIIC, polypeptide 2, beta 110kDa - PTPRF interacting protein, binding protein 2 (liprin beta 2) - ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 - potassium inwardly-rectifying channel, subfamily J, member 13 |