ST8SIA4-ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 Gene View larger

ST8SIA4-ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ST8SIA4-ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ST8SIA4-ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC027866
Product type: DNA & cDNA
Ncbi symbol: ST8SIA4
Origin species: Human
Product name: ST8SIA4-ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 Gene
Size: 2ug
Accessions: BC027866
Gene id: 7903
Gene description: ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4
Synonyms: PST; PST1; SIAT8D; ST8SIA-IV; CMP-N-acetylneuraminate-poly-alpha-2,8-sialyltransferase; CMP-N-acetylneuraminate-poly-alpha-2,8-sialyl transferase; SIAT8-D; ST8 alpha-N-acetylneuraminate alpha-2,8-sialyltransferase 4; ST8SiaIV; alpha-2,8-sialyltransferase 8D; polysialyltransferase-1; sialyltransferase 8 (alpha-2, 8-polysialytransferase) D; sialyltransferase 8D; sialyltransferase St8Sia IV; sialytransferase St8Sia IV; ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgctccattaggaagaagtggacgatctgcacaataagtctgctcctgatcttttataagacaaaagaaatagcaagaactgaggagcaccaggagacgcaactcatcggagatggtgaattgtctttgagtcggtcacttgtcaatagctctgataaaatcattcgaaaggctggctcttcaatcttccagcacaatgtagaaggttggaaaatcaattcctctttggtcctagagataaggaagaacatacttcgtttcttagatgcagaacgagatgtgtcagtggtcaagagcagttttaagcctggtgatgtcatacactatgtgcttgacaggcgccggacactaaacatttctcatgatctacatagcctcctacctgaagtttcaccaatgaagaatcgcaggtttaagacctgtgcagttgttggaaattctggcattctgttagacagtgaatgtggaaaggagattgacagtcacaattttgtaataaggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - potassium inwardly-rectifying channel, subfamily J, member 13
- potassium inwardly-rectifying channel, subfamily J, member 15
- KRR1, small subunit (SSU) processome component, homolog (yeast)
- UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2

Buy ST8SIA4-ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 Gene now

Add to cart