Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ST8SIA4-ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 Gene
PTXBC027866
New product
Data sheet of ST8SIA4-ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ST8SIA4-ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC027866 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ST8SIA4 |
| Origin species: | Human |
| Product name: | ST8SIA4-ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 Gene |
| Size: | 2ug |
| Accessions: | BC027866 |
| Gene id: | 7903 |
| Gene description: | ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 |
| Synonyms: | PST; PST1; SIAT8D; ST8SIA-IV; CMP-N-acetylneuraminate-poly-alpha-2,8-sialyltransferase; CMP-N-acetylneuraminate-poly-alpha-2,8-sialyl transferase; SIAT8-D; ST8 alpha-N-acetylneuraminate alpha-2,8-sialyltransferase 4; ST8SiaIV; alpha-2,8-sialyltransferase 8D; polysialyltransferase-1; sialyltransferase 8 (alpha-2, 8-polysialytransferase) D; sialyltransferase 8D; sialyltransferase St8Sia IV; sialytransferase St8Sia IV; ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcgctccattaggaagaagtggacgatctgcacaataagtctgctcctgatcttttataagacaaaagaaatagcaagaactgaggagcaccaggagacgcaactcatcggagatggtgaattgtctttgagtcggtcacttgtcaatagctctgataaaatcattcgaaaggctggctcttcaatcttccagcacaatgtagaaggttggaaaatcaattcctctttggtcctagagataaggaagaacatacttcgtttcttagatgcagaacgagatgtgtcagtggtcaagagcagttttaagcctggtgatgtcatacactatgtgcttgacaggcgccggacactaaacatttctcatgatctacatagcctcctacctgaagtttcaccaatgaagaatcgcaggtttaagacctgtgcagttgttggaaattctggcattctgttagacagtgaatgtggaaaggagattgacagtcacaattttgtaataaggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - potassium inwardly-rectifying channel, subfamily J, member 13 - potassium inwardly-rectifying channel, subfamily J, member 15 - KRR1, small subunit (SSU) processome component, homolog (yeast) - UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 |