KCNJ15-potassium inwardly-rectifying channel, subfamily J, member 15 Gene View larger

KCNJ15-potassium inwardly-rectifying channel, subfamily J, member 15 Gene

PTXBC013327

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KCNJ15-potassium inwardly-rectifying channel, subfamily J, member 15 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KCNJ15-potassium inwardly-rectifying channel, subfamily J, member 15 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013327
Product type: DNA & cDNA
Ncbi symbol: KCNJ15
Origin species: Human
Product name: KCNJ15-potassium inwardly-rectifying channel, subfamily J, member 15 Gene
Size: 2ug
Accessions: BC013327
Gene id: 3772
Gene description: potassium inwardly-rectifying channel, subfamily J, member 15
Synonyms: IRKK; KIR1.3; KIR4.2; ATP-sensitive inward rectifier potassium channel 15; inward rectifier K(+) channel Kir1.3; inward rectifier K(+) channel Kir4.2; inward rectifier K+ channel KIR4.2; potassium channel, inwardly rectifying subfamily J member 15; potassium inwardly-rectifying channel, subfamily J, member 15; potassium voltage-gated channel subfamily J member 15
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatgccattcacatcggcatgtccagcacccccctggtgaagcacactgctggggctgggctcaaggccaacagaccccgcgtcatgtccaagagtgggcacagcaacgtgagaattgacaaagtggatggcatatacctactctacctgcaagacctgtggaccacagttatcgacatgaagtggagatacaaactcaccctgttcgctgccacttttgtgatgacctggttcctttttggagtcatctactatgccatcgcgtttattcatggggacttagaacccggtgagcccatttcaaatcataccccctgcatcatgaaagtggactctctcactggggcgtttctcttttccctggaatcccagacaaccattggctatggagtccgttccatcacagaggaatgtcctcatgccatcttcctgttggttgctcagttggtcatcacgaccttgattgagatcttcatcaccggaaccttcctggccaaaatcgccagacccaaaaagcgggctgagaccatcaagttcagccactgtgcagtcatcaccaagcagaatgggaagctgtgcttggtgattcaggtagccaatatgaggaagagcctcttgattcagtgccagctctctggcaagctcctgcagacccacgtcaccaaggagggggagcggattctcctcaaccaagccactgtcaaattccacgtggactcctcctctgagagccccttcctcattctgcccatgacattctaccatgtgctggatgagacgagccccctgagagacctcacaccccaaaacctaaaggagaaggagtttgagcttgtggtcctcctcaatgccactgtggaatccaccagcgctgtctgccagagccgaacatcttatatcccagaggaaatctactggggttttgagtttgtgcctgtggtatctctctccaaaaatggaaaatatgtggctgatttcagtcagtttgaacagattcggaaaagcccagattgcacattttactgtgcagattctgagaaacagcaactcgaggagaagtacaggcaggaggatcagagggaaagagaactgaggacacttttattacaacagagcaatgtctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - KRR1, small subunit (SSU) processome component, homolog (yeast)
- UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2
- transcobalamin I (vitamin B12 binding protein, R binder family)
- solute carrier family 23 (nucleobase transporters), member 2

Buy KCNJ15-potassium inwardly-rectifying channel, subfamily J, member 15 Gene now

Add to cart