SLC23A2-solute carrier family 23 (nucleobase transporters), member 2 Gene View larger

SLC23A2-solute carrier family 23 (nucleobase transporters), member 2 Gene

PTXBC013112

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC23A2-solute carrier family 23 (nucleobase transporters), member 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLC23A2-solute carrier family 23 (nucleobase transporters), member 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013112
Product type: DNA & cDNA
Ncbi symbol: SLC23A2
Origin species: Human
Product name: SLC23A2-solute carrier family 23 (nucleobase transporters), member 2 Gene
Size: 2ug
Accessions: BC013112
Gene id: 9962
Gene description: solute carrier family 23 (nucleobase transporters), member 2
Synonyms: NBTL1; SLC23A1; SVCT2; YSPL2; hSVCT2; solute carrier family 23 member 2; Na(+)/L-ascorbic acid transporter 2; nucleobase transporter-like 1 protein; sodium-dependent vitamin C transporter-2; solute carrier family 23 (ascorbic acid transporter), member 2; solute carrier family 23 (nucleobase transporters), member 1; solute carrier family 23 (nucleobase transporters), member 2; testicular secretory protein Li 48; yolk sac permease-like molecule 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgggtattggtaagaataccacatccaaatcaatggaggctggaagttcaacagaaggcaaatacgaagacgaggcaaagcacccagctttcttcactcttccggtggtgataaatggaggcgccacctccagcggtgagcaggacaatgaggacactgagctcatggcgatctacactacggaaaacggcattgcagaaaagagctctctcgctgagaccctggatagcactggcagtctggacccccagcgatcagacatgatttataccatagaagatgttcctccctggtacctgtgtatatttctggggctacagcactacctgacatgcttcagcggcacgatcgcagtgcccttcctgttggccgatgccatgtgtgtggggtacgaccagtgggccaccagccagctcattgggaccattttcttctgtgtgggaatcactactttgctacagacaacgtttggatgcaggttacccctgtttcaggccagtgcttttgcatttttggcccctgctcgagccatcctgtctttagataaatggaaatgtaacaccacagatgtttcagttgccaatggaacagcagagctgttgcacacagaacacatctggtatccccggatccgagagatccagggggccatcatcatgtcctcactgatagaagtagtcatcggcctcctcggcctgcctggggctctactgaagtacatcggtcccttgaccattacacccacggtggccctaattggcctctctggtttccaggcagcgggggagagagccgggaagcactggggcattgccatgctgacaatattcctagtattactgttttctcaatacgccagaaatgttaaatttcctctcccgatttataaatccaagaaaggatggactgcgtacaagttacagctgttcaaaatgttccctatcatcctggccatcctggtatcctggctgctctgcttcatcttcacggtgacagacgtcttccctcccgacagcacaaagtatggcttctatgctcgcacagatgccaggcaaggcgtgcttctggtagccccgtggtttaaggttccatacccatttcagtggggactgcccaccgtgtctgcggccggtgtcatcggcatgctcagtgccgtggtcgccagcatcatcgagtctattggtgactactacgcctgtgcacggctgtcctgtgccccacccccccccatccacgcaataaacaggtacgttcctgagaagacaagttcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nerve growth factor receptor (TNFRSF16) associated protein 1
- NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa
- NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa
- deleted in a mouse model of primary ciliary dyskinesia

Buy SLC23A2-solute carrier family 23 (nucleobase transporters), member 2 Gene now

Add to cart