NGFRAP1-nerve growth factor receptor (TNFRSF16) associated protein 1 Gene View larger

NGFRAP1-nerve growth factor receptor (TNFRSF16) associated protein 1 Gene

PTXBC003190

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NGFRAP1-nerve growth factor receptor (TNFRSF16) associated protein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NGFRAP1-nerve growth factor receptor (TNFRSF16) associated protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003190
Product type: DNA & cDNA
Ncbi symbol: NGFRAP1
Origin species: Human
Product name: NGFRAP1-nerve growth factor receptor (TNFRSF16) associated protein 1 Gene
Size: 2ug
Accessions: BC003190
Gene id: 27018
Gene description: nerve growth factor receptor (TNFRSF16) associated protein 1
Synonyms: NGFRAP1; Bex; DXS6984E; HGR74; NADE; protein BEX3; brain-expressed X-linked protein 3; nerve growth factor receptor (TNFRSF16) associated protein 1; ovarian granulosa cell 13.0 kDa protein HGR74; p75NTR-associated cell death executor; brain expressed X-linked 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaaatattcaccaggaaaacgaagagatggagcagcctatgcagaatggagaggaagaccgccctttgggaggaggtgaaggccaccagcctgcaggaaatcgacggggacaggctcgccgacttgcccctaattttcgatgggccatacccaataggcagatcaatgatgggatgggtggagatggagatgatatggaaatattcatggaggagatgagagaaatcagaagaaaacttagggagctgcagttgaggaattgtctgcgtatccttatgggggagctctctaatcaccatgaccatcatgatgaattttgccttatgccttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa
- NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa
- deleted in a mouse model of primary ciliary dyskinesia
- uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae)

Buy NGFRAP1-nerve growth factor receptor (TNFRSF16) associated protein 1 Gene now

Add to cart