Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NGFRAP1-nerve growth factor receptor (TNFRSF16) associated protein 1 Gene
PTXBC003190
New product
Data sheet of NGFRAP1-nerve growth factor receptor (TNFRSF16) associated protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NGFRAP1-nerve growth factor receptor (TNFRSF16) associated protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003190 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NGFRAP1 |
| Origin species: | Human |
| Product name: | NGFRAP1-nerve growth factor receptor (TNFRSF16) associated protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC003190 |
| Gene id: | 27018 |
| Gene description: | nerve growth factor receptor (TNFRSF16) associated protein 1 |
| Synonyms: | NGFRAP1; Bex; DXS6984E; HGR74; NADE; protein BEX3; brain-expressed X-linked protein 3; nerve growth factor receptor (TNFRSF16) associated protein 1; ovarian granulosa cell 13.0 kDa protein HGR74; p75NTR-associated cell death executor; brain expressed X-linked 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcaaatattcaccaggaaaacgaagagatggagcagcctatgcagaatggagaggaagaccgccctttgggaggaggtgaaggccaccagcctgcaggaaatcgacggggacaggctcgccgacttgcccctaattttcgatgggccatacccaataggcagatcaatgatgggatgggtggagatggagatgatatggaaatattcatggaggagatgagagaaatcagaagaaaacttagggagctgcagttgaggaattgtctgcgtatccttatgggggagctctctaatcaccatgaccatcatgatgaattttgccttatgccttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa - NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa - deleted in a mouse model of primary ciliary dyskinesia - uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae) |