Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NDUFB10-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa Gene
PTXBC005829
New product
Data sheet of NDUFB10-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NDUFB10-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005829 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NDUFB10 |
| Origin species: | Human |
| Product name: | NDUFB10-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa Gene |
| Size: | 2ug |
| Accessions: | BC005829 |
| Gene id: | 4716 |
| Gene description: | NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa |
| Synonyms: | PDSW; NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 10; CI-PDSW; NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa; NADH ubiquinone oxidoreductase PDSW subunit (RH 16p13.3); NADH-ubiquinone oxidoreductase PDSW subunit; complex I PDSW subunit; complex I-PDSW; NADH:ubiquinone oxidoreductase subunit B10 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccggacagctgggacaaggatgtgtaccctgagcccccgcgccgcacgccggtgcagcccaatcccatcgtctacatgatgaaagcgttcgacctcatcgtggaccgacccgtgaccctcgtgagagaatttatagagcggcagcacgcaaagaacaggtattactactaccaccggcagtaccgccgcgtgccagacatcactgagtgcaaggaggaggacatcatgtgcatgtatgaagccgaaatgcagtggaagagggactacaaagtcgaccaagaaattatcaacattatgcaggatcggctcaaagcctgtcagcagagggaaggacagaactaccagcagaactgtatcaaggaagtggagcagttcacccaggtggccaaggcctaccaggaccgctatcaggacctgggggcctacagttctgccaggaagtgcctggccaaacagaggcagaggatgctgcaagagagaaaagctgcaaaagaggccgccgctgccacctcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - deleted in a mouse model of primary ciliary dyskinesia - uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae) - solute carrier family 25 (mitochondrial carrier), member 18 - tumor necrosis factor, alpha-induced protein 1 (endothelial) |