SLC25A18-solute carrier family 25 (mitochondrial carrier), member 18 Gene View larger

SLC25A18-solute carrier family 25 (mitochondrial carrier), member 18 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC25A18-solute carrier family 25 (mitochondrial carrier), member 18 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SLC25A18-solute carrier family 25 (mitochondrial carrier), member 18 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031644
Product type: DNA & cDNA
Ncbi symbol: SLC25A18
Origin species: Human
Product name: SLC25A18-solute carrier family 25 (mitochondrial carrier), member 18 Gene
Size: 2ug
Accessions: BC031644
Gene id: 83733
Gene description: solute carrier family 25 (mitochondrial carrier), member 18
Synonyms: GC2; mitochondrial glutamate carrier 2; glutamate/H(+) symporter 2; solute carrier family 25 (glutamate carrier), member 18; solute carrier family 25 (mitochondrial carrier), member 18; solute carrier family 25 member 18
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacccaccaggatctgagcatcacagccaaactcatcaatggaggtgtagcagggctcgtgggggtgacctgcgtgttccccatcgacttggccaagactcgcctgcagaaccagcatgggaaagccatgtacaaaggaatgatcgactgcctgatgaagacggctcgggcggagggcttcttcggcatgtaccgaggggctgcagtgaacctcactctggtcactccagagaaggccatcaagctggcggccaacgactttttccggcggctgctcatggaagatgggatgcagcggaacctgaagatggagatgcttgccgggtgtggggctgggatgtgccaggtcgtggtgacctgtcccatggaaatgctcaagattcagctgcaggatgctggacgcctggccgtccatcatcagggctcggcctcagcaccctccacctccaggtcctacacaactggttcggcttccacccacaggcgcccctctgccaccctcattgcctgggagctgctccgcactcagggcctggctgggctctacaggggcctgggtgccactctcctcagagacattcctttctccatcatctacttcccactgtttgccaaccttaacaacctggggttcaacgagctcgccggtaaggcgtcctttgcacattccttcgtgtcaggctgtgtggcaggttccatagctgcggtcgcagtgacgcctctagatgttctgaaaactcgaatccaaaccctcaagaaaggcctgggcgaggacatgtacagtgggatcaccgactgtgccaggaaactctggattcaggagggaccatctgccttcatgaaaggcgctggctgccgggcactggtcatagcacctctctttgggattgctcaaggggtctattttattgggattggagagcgcatcttaaagtgttttgactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tumor necrosis factor, alpha-induced protein 1 (endothelial)
- solute carrier family 29 (nucleoside transporters), member 2
- UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5
- potassium inwardly-rectifying channel, subfamily J, member 10

Buy SLC25A18-solute carrier family 25 (mitochondrial carrier), member 18 Gene now

Add to cart