Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SLC29A2-solute carrier family 29 (nucleoside transporters), member 2 Gene
PTXBC011387
New product
Data sheet of SLC29A2-solute carrier family 29 (nucleoside transporters), member 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC29A2-solute carrier family 29 (nucleoside transporters), member 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011387 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC29A2 |
| Origin species: | Human |
| Product name: | SLC29A2-solute carrier family 29 (nucleoside transporters), member 2 Gene |
| Size: | 2ug |
| Accessions: | BC011387 |
| Gene id: | 3177 |
| Gene description: | solute carrier family 29 (nucleoside transporters), member 2 |
| Synonyms: | DER12; ENT2; HNP36; equilibrative nucleoside transporter 2; 36 kDa nucleolar protein HNP36; delayed-early response protein 12; equilibrative NBMPR-insensitive nucleoside transporter; equilibrative nitrobenzylmercaptopurine riboside-insensitive nucleoside transporter; hydrophobic nucleolar protein, 36 kDa; hydrophobic nucleolar protein, 36kD; nucleoside transporter, ei-type; solute carrier family 29 (equilibrative nucleoside transporter), member 2; solute carrier family 29 (nucleoside transporters), member 2; solute carrier family 29 member 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgcgaggagacgccccgcgggacagctaccacctggtcgggatcagcttcttcatcctggggctgggcaccctccttccctggaacttcttcatcaccgccatcccgtacttccaggcgcgactggccggggccggcaacagcacagccaggatcctgagcaccaaccacacgggtcccgaggatgccttcaacttcaaccattgggtgacgctgctgtcccagctgcccctgctgctcttcaccctcctcaactccttcctgtaccagtgcgtcccggagacggtgcgcattctgggcagcctgctggccatactgctgctctttgccctgacagcagcgctggtcaaggtggacatgagccccggacccttcttctccatcaccatggcctccgtctgcttcatcaactccttcagtgcagtcctacagggcagcctcttcgggcagctgggcaccatgccctccacctacagcaccctcttcctcagcggccagggcctggctgggatctttgctgcccttgccatgctcctggccatggccagtggcgtggacgccgagacctctgccctggggtactttatcacgccctgtgtgggcatcctcatgtccatcgtgtgttacctgagcctgcctcacctgaagtttgcccgctactacctggccaataaatcatcccaggcccaagctcaggagctggagaccaaagctgagctcctccagtctgatctggctgacagcgctgtgccttgtgttggtcttcacagtcaccctgtccgtcttccccgccatcacagccatggtgaccagctccaccagtcctgggaagtggagtcagttcttcaaccccatctgctgcttcctcctcttcaacatcatggactggctgggacggagcctgacctcttacttcctgtggccagacgaggacagccggctgctgcccctgctggtctgcctgcggttcctgttcgtgcccctcttcatgctgtgccacgtgccccagaggtcccggctgcccatcctcttcccacaggatgcctacttcatcaccttcatgctgctctttgccgtttctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 - potassium inwardly-rectifying channel, subfamily J, member 10 - KRR1, small subunit (SSU) processome component, homolog (yeast) - mitogen-activated protein kinase-activated protein kinase 3 |