Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TNFAIP1-tumor necrosis factor, alpha-induced protein 1 (endothelial) Gene
PTXBC001643
New product
Data sheet of TNFAIP1-tumor necrosis factor, alpha-induced protein 1 (endothelial) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TNFAIP1-tumor necrosis factor, alpha-induced protein 1 (endothelial) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001643 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TNFAIP1 |
| Origin species: | Human |
| Product name: | TNFAIP1-tumor necrosis factor, alpha-induced protein 1 (endothelial) Gene |
| Size: | 2ug |
| Accessions: | BC001643 |
| Gene id: | 7126 |
| Gene description: | tumor necrosis factor, alpha-induced protein 1 (endothelial) |
| Synonyms: | BTB/POZ domain-containing protein TNFAIP1; B12; B61; BTBD34; EDP1; hBACURD2; BTB/POZ domain-containing adapter for CUL3-mediated RhoA degradation protein 2; tumor necrosis factor, alpha induced protein 1; tumor necrosis factor, alpha-induced protein 1 (endothelial); TNF alpha induced protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgggggacacctgcctgtgcccagcctcaggggccaagcccaagctcagtggcttcaagggaggagggttgggcaacaagtatgtccagctcaacgtgggcggctctctgtactacaccactgtgcgggccctgacccgccacgacaccatgctcaaggccatgttcagtgggcgcatggaggtgctgaccgacaaagaaggctggatcctcatagaccgttgtggaaagcactttggcaccattttgaattacctccgagatgacaccatcaccctccctcagaaccggcaagaaatcaaggaattgatggctgaagcaaagtattacctcatccaggggctggtgaatatgtgccagagtgccctgcaggacaagaaggactcctaccagcctgtgtgcaacatccccatcatcacatccctaaaggaggaggagcggctcatcgaatcctccaccaagcccgtggtgaagctgctgtacaacagaagcaacaacaagtattcctacaccagcaactctgacgaccacctgctgaaaaacatcgagctgtttgacaagctctccctgcgcttcaacggccgcgtgctcttcatcaaggatgtcattggtgacgagatctgctgctggtccttttatggccagggccgtaagctggcagaggtgtgctgtacctccatcgtgtatgccacggagaagaagcagaccaaggtggaattcccagaggcccgaatctatgaggagacactcaacgtcctactctatgagactccccgcgtccccgacaactccttgttggaggccacaagccgtagccgcagccaggcttcccccagtgaagatgaggagacctttgaactgcgggaccgtgtccgccgcatccacgtcaagcgctacagcacttacgatgaccggcagctcggccaccagtctacccatcgcgactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 29 (nucleoside transporters), member 2 - UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 - potassium inwardly-rectifying channel, subfamily J, member 10 - KRR1, small subunit (SSU) processome component, homolog (yeast) |