Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
RP11-529I10.4-deleted in a mouse model of primary ciliary dyskinesia Gene
PTXBC001082
New product
Data sheet of RP11-529I10.4-deleted in a mouse model of primary ciliary dyskinesia Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RP11-529I10.4-deleted in a mouse model of primary ciliary dyskinesia Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001082 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RP11-529I10.4 |
| Origin species: | Human |
| Product name: | RP11-529I10.4-deleted in a mouse model of primary ciliary dyskinesia Gene |
| Size: | 2ug |
| Accessions: | BC001082 |
| Gene id: | 25911 |
| Gene description: | deleted in a mouse model of primary ciliary dyskinesia |
| Synonyms: | RP11-529I10.4; protein DPCD; deleted in a mouse model of primary ciliary dyskinesia; deleted in primary ciliary dyskinesia homolog (mouse) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggtgacgggctggttggagagtctgcggacagcccagaagactgcgctgctgcaggacgggagaaggaaggttcactatttattcccagacggcaaggaaatggctgaagaatatgacgagaagacgagtgaactacttgtgagaaagtggcgtgtgaaaagtgccctgggagccatgggccagtggcagcttgaagtaggagacccagcgcccctaggagcagggaacctggggcctgaactcatcaaggaaagcaatgccaatcctatcttcatgcgcaaggacaccaagatgagtttccagtggcggattcgaaacctcccctatcctaaggatgtctatagtgtctctgtggaccagaaggagcgctgcatcattgtcagaacaaccaacaagaagtactacaagaagttctccattcctgatctagatagacaccagctacctctggatgacgccttgctgagctttgcccacgccaactgcaccctgatcatctcttaccagaagccaaaggaggttgtggtggccgagtctgagctacagaaggaactaaagaaggtgaagacagcccacagcaacgatggggactgcaagacccagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae) - solute carrier family 25 (mitochondrial carrier), member 18 - tumor necrosis factor, alpha-induced protein 1 (endothelial) - solute carrier family 29 (nucleoside transporters), member 2 |