Cart 1 Product Products 113,40 € (empty)
-
1 x RHEB-Ras...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
View larger 
UPRT-uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae) Gene
PTXBC015116
New product
Data sheet of UPRT-uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UPRT-uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015116 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UPRT |
| Origin species: | Human |
| Product name: | UPRT-uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC015116 |
| Gene id: | 139596 |
| Gene description: | uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae) |
| Synonyms: | FUR1; UPP; uracil phosphoribosyltransferase homolog; RP11-311P8.3; UMP pyrophosphorylase; UPRTase; uracil phosphoribosyltransferase (FUR1) homolog |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccacggagttacagtgtccggactccatgccctgtcacaaccagcaagtaaactctgcctcaaccccaagtcccgagcagctgcgacctggcgatctgatcctggaccacgcagggggaaacagagcctccagggccaaggtgattctcctcacggggtacgcccattctagcctgccggccgagctggactctggggcctgcggcggctccagcctcaactcagagggcaacagtggtagtggtgacagtagcagctatgacgcaccagctggcaactccttcctagaggactgcgaactctcccggcagatcggggcgcagcttaagctgctgcctatgaatgatcagatacgggagctacagaccatcatccgggacaagacagccagtagaggtgacttcatgttttctgcggatcgtttgatcagacttgttgtggaagagggattgaatcagctgccatataaagaatgcatggtgaccactccaacagggtacaagtatgaaggagtgaaatttgagaagggaaattgtggggtcagcataatgagaagcggtgaggcaatggaacaaggtttacgagactgctgtcgatccatacgaattggaaagatcctgattcagagtgatgaggagacacaaagagccaaagtatattatgccaaattccccccagacatttaccggagaaaagtccttctgatgtatccaattctcagcactggaaatactgtaattgaagctgtaaaggttcttatagaacatggagttcaacccagtgttatcatcctactcagtctgttctccactcctcatggtgccaaatcaatcattcaggagtttccagagatcacaattttaactactgaagttcatcctgttgcacctacacattttggacagaaatactttggaacagactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 25 (mitochondrial carrier), member 18 - tumor necrosis factor, alpha-induced protein 1 (endothelial) - solute carrier family 29 (nucleoside transporters), member 2 - UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 |