UPRT-uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae) Gene View larger

UPRT-uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UPRT-uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about UPRT-uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015116
Product type: DNA & cDNA
Ncbi symbol: UPRT
Origin species: Human
Product name: UPRT-uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC015116
Gene id: 139596
Gene description: uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae)
Synonyms: FUR1; UPP; uracil phosphoribosyltransferase homolog; RP11-311P8.3; UMP pyrophosphorylase; UPRTase; uracil phosphoribosyltransferase (FUR1) homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccacggagttacagtgtccggactccatgccctgtcacaaccagcaagtaaactctgcctcaaccccaagtcccgagcagctgcgacctggcgatctgatcctggaccacgcagggggaaacagagcctccagggccaaggtgattctcctcacggggtacgcccattctagcctgccggccgagctggactctggggcctgcggcggctccagcctcaactcagagggcaacagtggtagtggtgacagtagcagctatgacgcaccagctggcaactccttcctagaggactgcgaactctcccggcagatcggggcgcagcttaagctgctgcctatgaatgatcagatacgggagctacagaccatcatccgggacaagacagccagtagaggtgacttcatgttttctgcggatcgtttgatcagacttgttgtggaagagggattgaatcagctgccatataaagaatgcatggtgaccactccaacagggtacaagtatgaaggagtgaaatttgagaagggaaattgtggggtcagcataatgagaagcggtgaggcaatggaacaaggtttacgagactgctgtcgatccatacgaattggaaagatcctgattcagagtgatgaggagacacaaagagccaaagtatattatgccaaattccccccagacatttaccggagaaaagtccttctgatgtatccaattctcagcactggaaatactgtaattgaagctgtaaaggttcttatagaacatggagttcaacccagtgttatcatcctactcagtctgttctccactcctcatggtgccaaatcaatcattcaggagtttccagagatcacaattttaactactgaagttcatcctgttgcacctacacattttggacagaaatactttggaacagactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 25 (mitochondrial carrier), member 18
- tumor necrosis factor, alpha-induced protein 1 (endothelial)
- solute carrier family 29 (nucleoside transporters), member 2
- UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5

Buy UPRT-uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae) Gene now

Add to cart