Login to display prices
Login to display prices
NDUFB10-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa Gene View larger

NDUFB10-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa Gene

PTXBC007509

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NDUFB10-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NDUFB10-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa Gene

Proteogenix catalog: PTXBC007509
Ncbi symbol: NDUFB10
Product name: NDUFB10-NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa Gene
Size: 2ug
Accessions: BC007509
Gene id: 4716
Gene description: NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa
Synonyms: PDSW; NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 10; CI-PDSW; NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa; NADH ubiquinone oxidoreductase PDSW subunit (RH 16p13.3); NADH-ubiquinone oxidoreductase PDSW subunit; complex I PDSW subunit; complex I-PDSW; NADH:ubiquinone oxidoreductase subunit B10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccggacagctgggacaaggatgtgtaccctgagcccccgcgccgcacgccggtgcagcccaatcccatcgtctacatgatgaaagcgttcgacctcatcgtggaccgacccgtgaccctcgtgagagaatttatagagcggcagcacgcaaagaacaggtattactactaccaccggcagtaccgccgcgtgccagacatcactgagtgcaaggaggaggacatcatgtgcatgtatgaagccgaaatgcagtggaagagggactacaaagtcgaccaagaaattatcaacattatgcaggatcggctcaaagcctgtcagcagagggaaggacagaactaccagcagaactgtatcaaggaagtggagcagttcacccaggtggccaaggcctaccaggaccgctgtgcgtgccccacccacccccaaccccccaccatcctcctgaggcctgggggccagaaccattgcaaatcttccctcccctcccttgtgctcacttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice