TCN1-transcobalamin I (vitamin B12 binding protein, R binder family) Gene View larger

TCN1-transcobalamin I (vitamin B12 binding protein, R binder family) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TCN1-transcobalamin I (vitamin B12 binding protein, R binder family) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TCN1-transcobalamin I (vitamin B12 binding protein, R binder family) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018632
Product type: DNA & cDNA
Ncbi symbol: TCN1
Origin species: Human
Product name: TCN1-transcobalamin I (vitamin B12 binding protein, R binder family) Gene
Size: 2ug
Accessions: BC018632
Gene id: 6947
Gene description: transcobalamin I (vitamin B12 binding protein, R binder family)
Synonyms: TC-1; TC1; TCI; transcobalamin-1; haptocorin; haptocorrin; protein R; transcobalamin I (vitamin B12 binding protein, R binder family); transcobalamin 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagacagtcacaccagctgcccctagtggggctcttactgttttcttttattccaagccaactatgcgagatttgtgaggtaagtgaagaaaactacatccgcctaaaacctctgttgaatacaatgatccagtcaaactataacaggggaaccagcgctgtcaatgttgtgttgtccctcaaacttgttggaatccagatccaaaccctgatgcaaaagatgatccaacaaatcaaatacaatgtgaaaagcagattgtcagatgtaagctcgggagagcttgccttgattatactggctttgggagtatgtcgtaacgctgaggaaaacttaatatatgattaccacctgatcgacaagctagaaaataaattccaagcagaaattgaaaatatggaagcacacaatggcactcccctgactaactactaccagctcagcctggacgttttggccttgtgtctgttcaatgggaactactcaaccgccgaagttgtcaaccacttcactcctgaaaataaaaactattattttggtagccagttctcagtagatactggtgcaatggctgtcctggctctgacctgtgtgaagaagagtctaataaatgggcagatcaaagcagatgaaggcagtttaaagaacatcagtatttatacaaagtcactggtagaaaagattctgtctgagaaaaaagaaaatggtctcattggaaacacatttagcacaggagaagccatgcaggccctctttgtatcatcagactattataatgaaaatgactggaattgccaacaaactctgaatacagtgctcacggaaatttctcaaggagcattcagtaatccaaacgctgcagcccaggtcttacctgccctgatgggaaagaccttcttggatattaacaaagactcttcttgcgtctctgcttcaggtaacttcaacatctccgctgatgagcctataactgtgacacctcctgactcacaatcatatatctccgtcaattactctgtgagaatcaatgaaacatatttcaccaatgtcactgtgctaaatggttctgtcttcctcagtgtgatggagaaagcccagaaaatgaatgatactatatttggtttcacaatggaggagcgctcatgggggccctatatcacctgtattcagggcctatgtgccaacaataatgacagaacctactgggaacttctgagtggaggcgaaccactgagccaaggagctggtagttacgttgtccgcaatggataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 23 (nucleobase transporters), member 2
- nerve growth factor receptor (TNFRSF16) associated protein 1
- NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa
- NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa

Buy TCN1-transcobalamin I (vitamin B12 binding protein, R binder family) Gene now

Add to cart