Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
KCNJ13-potassium inwardly-rectifying channel, subfamily J, member 13 Gene
PTXBC037290
New product
Data sheet of KCNJ13-potassium inwardly-rectifying channel, subfamily J, member 13 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KCNJ13-potassium inwardly-rectifying channel, subfamily J, member 13 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC037290 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KCNJ13 |
| Origin species: | Human |
| Product name: | KCNJ13-potassium inwardly-rectifying channel, subfamily J, member 13 Gene |
| Size: | 2ug |
| Accessions: | BC037290 |
| Gene id: | 3769 |
| Gene description: | potassium inwardly-rectifying channel, subfamily J, member 13 |
| Synonyms: | KIR1.4; KIR7.1; LCA16; SVD; inward rectifier potassium channel 13; inward rectifier K(+) channel Kir7.1; potassium channel, inwardly rectifying subfamily J, member 13; potassium inwardly-rectifying channel, subfamily J, member 13; potassium voltage-gated channel subfamily J member 13 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacagcagtaattgcaaagttattgctcctctcctaagtcaaagataccggaggatggtcaccaaggatggccacagcacacttcaaatggatggcgctcaaagaggtcttgcatatcttcgagatgcttggggaatcctaatggacatgcgctggcgttggatgatgttggtcttttctgcttcttttgttgtccactggcttgtctttgcagtgctctggtatgttctggctgagatgaatggtgatctggaactagatcatgatgccccacctgaaaaccacactatctgtgtcaagtatatcaccagtttcacagctgcattctccttctccctggagacacaactcacaattggttatggtaccatgttccccagtggtgactgtccaagtgcaatcgccttacttgccatacaaatgctcctaggcctcatgctagaggcttttatcacaggtgcttttgtggcgaagattgcccggccaaaaaatcgagctttttcaattcgctttactgacatagcagtagtagctcacatggatggcaaacctaatcttatcttccaagtggccaacacccgacctagccctctaaccagtgtccgggtctcagctgtactctatcaggaaagagaaaatggcaaactctaccagaccagtgtggatttccaccttgatggcatcagttctgacgaatgtccattcttcatctttccactaacgtactatcactccattacaccatcaagtcctctggctactctgctccagcatgaaaatccttctcactttgaattagttgtattcctttcagcaatgcaggagggcactggagaaatatgccaaaggaggacatcctacctacagtctgaaatcatgttacatcactgttttgcatctctgttgacccgaggttccaaatgtgaatatcaaatcaagatggagaattttgacaagactgtccctgaatttccaactcctctggtttctaaaagcccaaacaggactgacctggatatccacatcaatggacaaagcattgacaattttcagatctctgaaacaggactgacagaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - potassium inwardly-rectifying channel, subfamily J, member 15 - KRR1, small subunit (SSU) processome component, homolog (yeast) - UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 - transcobalamin I (vitamin B12 binding protein, R binder family) |