Login to display prices
Login to display prices
KCNJ13-potassium inwardly-rectifying channel, subfamily J, member 13 Gene View larger

KCNJ13-potassium inwardly-rectifying channel, subfamily J, member 13 Gene

PTXBC037290

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KCNJ13-potassium inwardly-rectifying channel, subfamily J, member 13 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KCNJ13-potassium inwardly-rectifying channel, subfamily J, member 13 Gene

Proteogenix catalog: PTXBC037290
Ncbi symbol: KCNJ13
Product name: KCNJ13-potassium inwardly-rectifying channel, subfamily J, member 13 Gene
Size: 2ug
Accessions: BC037290
Gene id: 3769
Gene description: potassium inwardly-rectifying channel, subfamily J, member 13
Synonyms: KIR1.4; KIR7.1; LCA16; SVD; inward rectifier potassium channel 13; inward rectifier K(+) channel Kir7.1; potassium channel, inwardly rectifying subfamily J, member 13; potassium inwardly-rectifying channel, subfamily J, member 13; potassium voltage-gated channel subfamily J member 13
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacagcagtaattgcaaagttattgctcctctcctaagtcaaagataccggaggatggtcaccaaggatggccacagcacacttcaaatggatggcgctcaaagaggtcttgcatatcttcgagatgcttggggaatcctaatggacatgcgctggcgttggatgatgttggtcttttctgcttcttttgttgtccactggcttgtctttgcagtgctctggtatgttctggctgagatgaatggtgatctggaactagatcatgatgccccacctgaaaaccacactatctgtgtcaagtatatcaccagtttcacagctgcattctccttctccctggagacacaactcacaattggttatggtaccatgttccccagtggtgactgtccaagtgcaatcgccttacttgccatacaaatgctcctaggcctcatgctagaggcttttatcacaggtgcttttgtggcgaagattgcccggccaaaaaatcgagctttttcaattcgctttactgacatagcagtagtagctcacatggatggcaaacctaatcttatcttccaagtggccaacacccgacctagccctctaaccagtgtccgggtctcagctgtactctatcaggaaagagaaaatggcaaactctaccagaccagtgtggatttccaccttgatggcatcagttctgacgaatgtccattcttcatctttccactaacgtactatcactccattacaccatcaagtcctctggctactctgctccagcatgaaaatccttctcactttgaattagttgtattcctttcagcaatgcaggagggcactggagaaatatgccaaaggaggacatcctacctacagtctgaaatcatgttacatcactgttttgcatctctgttgacccgaggttccaaatgtgaatatcaaatcaagatggagaattttgacaagactgtccctgaatttccaactcctctggtttctaaaagcccaaacaggactgacctggatatccacatcaatggacaaagcattgacaattttcagatctctgaaacaggactgacagaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: