GTF3C2-general transcription factor IIIC, polypeptide 2, beta 110kDa Gene View larger

GTF3C2-general transcription factor IIIC, polypeptide 2, beta 110kDa Gene

PTXBC000212

New product

Data sheet of GTF3C2-general transcription factor IIIC, polypeptide 2, beta 110kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GTF3C2-general transcription factor IIIC, polypeptide 2, beta 110kDa Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC000212
Product type: DNA & cDNA
Ncbi symbol: GTF3C2
Origin species: Human
Product name: GTF3C2-general transcription factor IIIC, polypeptide 2, beta 110kDa Gene
Size: 2ug
Accessions: BC000212
Gene id: 2976
Gene description: general transcription factor IIIC, polypeptide 2, beta 110kDa
Synonyms: TFIIIC-BETA; TFIIIC110; general transcription factor 3C polypeptide 2; TF3C-beta; TFIIIC 110 kDa subunit; general transcription factor IIIC, polypeptide 2, beta 110kDa; transcription factor IIIC 110 kDa subunit; transcription factor IIIC subunit beta; general transcription factor IIIC subunit 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatacctgcggggtcggctatgttgccctgggggaggccggccccgtggggaacatgactgtggtagactctcctggacaagaggtgctaaatcagcttgatgtcaagacctcttcagaaatgaccagtgcagaggcttccgtagagatgtcattacctacccctttgcctggatttgaggattctcctgatcagaggaggctccctccagagcaggaaagcctctccagactggaacagccagatctttcttcagagatgtcaaaggtctcaaagcctagggcctcaaagcctggccggaagagaggtggtaggacacgaaaaggccccaaaaggccccaacagcctaatcctccatcagccccactggttcctggtctcttagatcaatccaaccctctgtccacccccatgcctaagaaacgaggtcgaaagtccaaggcagagctgctgctgctgaagttgtcaaaagacctagatcggccagaatctcaatctccaaagaggccccctgaggactttgagaccccttctggggaacgaccccgccgaagggctgcccaagtggcacttctgtatcttcaggaactggctgaagagctctcaacagccctgcctgcccctgtgtcctgtcctgagggccccaaggtgagcagccccaccaaaccgaagaagatccggcagccagcagcctgtccaggtggagaagaggtggatggtgctccacgggatgaagacttttttctccaggttgaggctgaagatgtggaagaaagtgagggcccaagtgagagctcatctgaacctgagcctgtagtgccccgaagcaccccacgaggatctacttcagggaaacagaaaccacactgccgaggaatggctcccaatggcttaccaaatcatatcatggctcctgtttggaagtgcctccatctcaccaaggacttccgagagcagaaacattcatactgggagtttgctgagtggattcctttagcctggaagtggcacttgttatctgagcttgaggccgctccctacctgccccaggaggagaagtctccattgttttctgtacaacgtgaagggctacctgaagatggcaccctctaccgaataaacagatttagctcgatcacagcacatccagagcgctgggatgtgtccttcttcacggggggaccgctctgggctctggactggtgcccagtgccagagggggcaggagcctcgcaatatgtggctcttttctccagccctgacatgaatgagacacacccactgagccagcttcattcgggtcctgggctgctccagctctggggccttgggaccttgcagcaagaaagctgtcctggcaacagggcccactttgtctatgggattgcttgtgacaacggctgcatctgggacctcaagttctgccccagtggagcatgggaacttccaggcacccctcggaaggctcctctcctgccccggttgggtctcttggctctggcctgctcagacgggaaagtactgctattcagtctaccccatccggaggccctgctggctcagcaacccccagatgcagtgaagcctgccatatataaggtacaatgtgtggcaactctgcaggtggggtctatgcaagctacagacccctctgagtgtggtcagtgccttagcctggcctggatgcctaccaggccccaccaacacctagctgctggatattataatggtaaaaaaaaccaaaataaaacataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - PTPRF interacting protein, binding protein 2 (liprin beta 2)
- ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4
- potassium inwardly-rectifying channel, subfamily J, member 13
- potassium inwardly-rectifying channel, subfamily J, member 15

Buy GTF3C2-general transcription factor IIIC, polypeptide 2, beta 110kDa Gene now

Add to cart