Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NDUFA1-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa Gene
PTXBC000266
New product
Data sheet of NDUFA1-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NDUFA1-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000266 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NDUFA1 |
| Origin species: | Human |
| Product name: | NDUFA1-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa Gene |
| Size: | 2ug |
| Accessions: | BC000266 |
| Gene id: | 4694 |
| Gene description: | NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa |
| Synonyms: | CI-MWFE; MWFE; ZNF183; NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 1; NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa; NADH oxidoreductase subunit MWFE; NADH-ubiquinone oxidoreductase MWFE subunit; NADH:ubiquinone oxidoreductase (complex 1); complex I MWFE subunit; complex I-MWFE; type I dehydrogenase; NADH:ubiquinone oxidoreductase subunit A1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtggttcgagattctccccggactctccgtcatgggcgtgtgcttgttgattccaggactggctactgcgtacatccacaggttcactaacgggggcaaggaaaaaagggttgctcattttgggtatcactggagtctgatggaaagagataggcgcatctctggagttgatcgttactatgtgtcaaagggtttggagaacattgattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - general transcription factor IIIC, polypeptide 6, alpha 35kDa - KRR1, small subunit (SSU) processome component, homolog (yeast) - general transcription factor IIIC, polypeptide 2, beta 110kDa - PTPRF interacting protein, binding protein 2 (liprin beta 2) |