NDUFA1-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa Gene View larger

NDUFA1-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa Gene

PTXBC000266

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NDUFA1-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NDUFA1-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000266
Product type: DNA & cDNA
Ncbi symbol: NDUFA1
Origin species: Human
Product name: NDUFA1-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa Gene
Size: 2ug
Accessions: BC000266
Gene id: 4694
Gene description: NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa
Synonyms: CI-MWFE; MWFE; ZNF183; NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 1; NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa; NADH oxidoreductase subunit MWFE; NADH-ubiquinone oxidoreductase MWFE subunit; NADH:ubiquinone oxidoreductase (complex 1); complex I MWFE subunit; complex I-MWFE; type I dehydrogenase; NADH:ubiquinone oxidoreductase subunit A1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggttcgagattctccccggactctccgtcatgggcgtgtgcttgttgattccaggactggctactgcgtacatccacaggttcactaacgggggcaaggaaaaaagggttgctcattttgggtatcactggagtctgatggaaagagataggcgcatctctggagttgatcgttactatgtgtcaaagggtttggagaacattgattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - general transcription factor IIIC, polypeptide 6, alpha 35kDa
- KRR1, small subunit (SSU) processome component, homolog (yeast)
- general transcription factor IIIC, polypeptide 2, beta 110kDa
- PTPRF interacting protein, binding protein 2 (liprin beta 2)

Buy NDUFA1-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa Gene now

Add to cart