Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GTF3C6-general transcription factor IIIC, polypeptide 6, alpha 35kDa Gene
PTXBC011593
New product
Data sheet of GTF3C6-general transcription factor IIIC, polypeptide 6, alpha 35kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GTF3C6-general transcription factor IIIC, polypeptide 6, alpha 35kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011593 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GTF3C6 |
| Origin species: | Human |
| Product name: | GTF3C6-general transcription factor IIIC, polypeptide 6, alpha 35kDa Gene |
| Size: | 2ug |
| Accessions: | BC011593 |
| Gene id: | 112495 |
| Gene description: | general transcription factor IIIC, polypeptide 6, alpha 35kDa |
| Synonyms: | C6orf51; TFIIIC35; bA397G5.3; general transcription factor 3C polypeptide 6; TFIIIC 35 kDa subunit; general transcription factor IIIC, polypeptide 6, alpha 35kDa; transcription factor IIIC 35 kDa subunit; transcription factor IIIC 35kDa; transcription factor IIIC subunit 6; general transcription factor IIIC subunit 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcggcggcggacgagcggagtccagaggacggagaagacgaggaagaggaggagcagttggttctggtggaattatcaggaattattgattcagacttcctctcaaaatgtgaaaataaatgcaaggttttgggcattgacactgagaggcccattctgcaagtggacagctgtgtctttgctggggagtatgaagacactctagggacctgtgttatatttgaagaaaatgttgaacatgctgatacagaaggcaataataaaacagtgctaaaatataaatgccatacaatgaagaagctcagcatgacaagaactctcctgacagagaagaaggaaggagaagaaaacataggtggggtggaatggctgcaaataaaggataatgatttctcctatcgacccaacatgatttgtaactttctacatgaaaatgaagacgaagaagtggtagcttcagccccagataaatctttggaattggaagaggaagagattcaaatgaacgacagttcaaacctgagttgtgaacaggagaaaccaatgcacttggaaatagaagattctggtcctcttattgatataccttctgagacagaaggttctgtttttatggaaactcaaatgctgccttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - KRR1, small subunit (SSU) processome component, homolog (yeast) - general transcription factor IIIC, polypeptide 2, beta 110kDa - PTPRF interacting protein, binding protein 2 (liprin beta 2) - ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 |