PRPSAP1-phosphoribosyl pyrophosphate synthetase-associated protein 1 Gene View larger

PRPSAP1-phosphoribosyl pyrophosphate synthetase-associated protein 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PRPSAP1-phosphoribosyl pyrophosphate synthetase-associated protein 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PRPSAP1-phosphoribosyl pyrophosphate synthetase-associated protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009012
Product type: DNA & cDNA
Ncbi symbol: PRPSAP1
Origin species: Human
Product name: PRPSAP1-phosphoribosyl pyrophosphate synthetase-associated protein 1 Gene
Size: 2ug
Accessions: BC009012
Gene id: 5635
Gene description: phosphoribosyl pyrophosphate synthetase-associated protein 1
Synonyms: PAP39; phosphoribosyl pyrophosphate synthase-associated protein 1; 39 kDa phosphoribosypyrophosphate synthase-associated protein; PRPP synthase-associated protein 1; phosphoribosyl pyrophosphate synthetase associated protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacgccgctcgcaccggctaccgagtcttctcggccaactccacggccgcctgcacggagctggccaagcgcatcacagagcgccttggtgctgaattggggaagtctgttgtatatcaagagaccaatggagaaacaagagttgaaataaaagaatctgttcgtggccaagatattttcattatacagacaatacccagagatgtgaatacagctgtgatggagttgctcatcatggcttacgcactgaagactgcctgtgccaggaacattattggggtcatcccctacttcccctacagcaagcagagcaagatgaggaagaggggttccattgtgtgcaagctgctagcatccatgctggcgaaagcaggtttaactcacattatcactatggatcttcatcaaaaggaaatacaaggctttttcagctttcctgtggacaaccttagagcctcacctttcctgcttcagtatatccaggaagaaattccaaattacagaaatgcagtcattgtagctaagtctcctgatgctgcaaagagggcccagtcctatgcggagagactgcgtctgggtttggccgtcattcacggggaagctcagtgcacggaactggacatggacgatggtcgtcactccccgcctatggtcaaaaatgctactgtgcacccaggcctggagttgccattgatgatggccaaagagaagccaccgataactgtagttggagatgttggaggccgcatcgcaatcatcgtggatgacattattgacgatgtggagagttttgttgctgccgcggagatcctgaaagagagaggcgcctataagatctatgttatggccacccacggcatcctgtctgcagaggcccctcgcctgattgaggagtcctccgtagacgaggtggtggtgacgaatactgtccctcatgaggttcagaagctgcagtgtcccaagataaagactgtggatatcagtttgattctttctgaagccattcggagaatccacaatggagagtccatggcctaccttttccgaaacatcactgtggatgactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - glutamate receptor, ionotropic, N-methyl D-aspartate-like 1A
- serum deprivation response (phosphatidylserine binding protein)
- NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa
- general transcription factor IIIC, polypeptide 6, alpha 35kDa

Buy PRPSAP1-phosphoribosyl pyrophosphate synthetase-associated protein 1 Gene now

Add to cart