Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PRPSAP1-phosphoribosyl pyrophosphate synthetase-associated protein 1 Gene
PTXBC009012
New product
Data sheet of PRPSAP1-phosphoribosyl pyrophosphate synthetase-associated protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PRPSAP1-phosphoribosyl pyrophosphate synthetase-associated protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009012 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PRPSAP1 |
| Origin species: | Human |
| Product name: | PRPSAP1-phosphoribosyl pyrophosphate synthetase-associated protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC009012 |
| Gene id: | 5635 |
| Gene description: | phosphoribosyl pyrophosphate synthetase-associated protein 1 |
| Synonyms: | PAP39; phosphoribosyl pyrophosphate synthase-associated protein 1; 39 kDa phosphoribosypyrophosphate synthase-associated protein; PRPP synthase-associated protein 1; phosphoribosyl pyrophosphate synthetase associated protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaacgccgctcgcaccggctaccgagtcttctcggccaactccacggccgcctgcacggagctggccaagcgcatcacagagcgccttggtgctgaattggggaagtctgttgtatatcaagagaccaatggagaaacaagagttgaaataaaagaatctgttcgtggccaagatattttcattatacagacaatacccagagatgtgaatacagctgtgatggagttgctcatcatggcttacgcactgaagactgcctgtgccaggaacattattggggtcatcccctacttcccctacagcaagcagagcaagatgaggaagaggggttccattgtgtgcaagctgctagcatccatgctggcgaaagcaggtttaactcacattatcactatggatcttcatcaaaaggaaatacaaggctttttcagctttcctgtggacaaccttagagcctcacctttcctgcttcagtatatccaggaagaaattccaaattacagaaatgcagtcattgtagctaagtctcctgatgctgcaaagagggcccagtcctatgcggagagactgcgtctgggtttggccgtcattcacggggaagctcagtgcacggaactggacatggacgatggtcgtcactccccgcctatggtcaaaaatgctactgtgcacccaggcctggagttgccattgatgatggccaaagagaagccaccgataactgtagttggagatgttggaggccgcatcgcaatcatcgtggatgacattattgacgatgtggagagttttgttgctgccgcggagatcctgaaagagagaggcgcctataagatctatgttatggccacccacggcatcctgtctgcagaggcccctcgcctgattgaggagtcctccgtagacgaggtggtggtgacgaatactgtccctcatgaggttcagaagctgcagtgtcccaagataaagactgtggatatcagtttgattctttctgaagccattcggagaatccacaatggagagtccatggcctaccttttccgaaacatcactgtggatgactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - glutamate receptor, ionotropic, N-methyl D-aspartate-like 1A - serum deprivation response (phosphatidylserine binding protein) - NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa - general transcription factor IIIC, polypeptide 6, alpha 35kDa |