SLC23A1-solute carrier family 23 (nucleobase transporters), member 1 Gene View larger

SLC23A1-solute carrier family 23 (nucleobase transporters), member 1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC23A1-solute carrier family 23 (nucleobase transporters), member 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SLC23A1-solute carrier family 23 (nucleobase transporters), member 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC019225
Product type: DNA & cDNA
Ncbi symbol: SLC23A1
Origin species: Human
Product name: SLC23A1-solute carrier family 23 (nucleobase transporters), member 1 Gene
Size: 2ug
Accessions: BC019225
Gene id: 9963
Gene description: solute carrier family 23 (nucleobase transporters), member 1
Synonyms: SLC23A2; SVCT1; YSPL3; solute carrier family 23 member 1; Na(+)/L-ascorbic acid transporter 1; hSVCT1; sodium-dependent vitamin C transporter-1; solute carrier family 23 (ascorbic acid transporter), member 1; solute carrier family 23 (nucleobase transporters), member 1; solute carrier family 23 (nucleobase transporters), member 2; yolk sac permease-like molecule 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagggcccaggaggacctcgagggccggacacagcatgaaaccaccagggacccctcgaccccgctacccacagagcctaagtttgacatgttgtacaagatcgaggacgtgccaccttggtacctgtgcatcctgctgggcttccagcactacctgacatgcttcagtggtaccatcgccgtgcccttcctgctggctgaggcgctgtgtgtgggccacgaccagcacatggttagtcagctcatcggcaccatcttcacgtgcgtgggcatgttctgcactctctttggcatgattacagctgtggggctgtccaacctgcaatttgtggacatgaactcctctcgcaacctcttcgtgctgggattttccatgttcttcgggctcacgctgcccaattacctggagtccaaccctggcgccatcaatacaggcattcttgaagtggatcagattctgattgtgctgctgaccacggagatgtttgtgggcgggtgccttgctttcatacttgacaacacagtgccagggagcccagaggagcgtggtctgatacagtggaaagctggggctcatgccaacagtgacatgtcttccagcctcaagagctacgatttccccattgggatgggcatagtaaaaagaattacctttctgaaatacattcctatctgcccagtcttcaaaggattttcttcaagttcaaaagatcagattgcaattccagaagacactccagaaaatacagaaactgcatctgtgtgcaccaaggtctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phosphoribosyl pyrophosphate synthetase-associated protein 1
- glutamate receptor, ionotropic, N-methyl D-aspartate-like 1A
- serum deprivation response (phosphatidylserine binding protein)
- NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa

Buy SLC23A1-solute carrier family 23 (nucleobase transporters), member 1 Gene now

Add to cart