Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SLC23A1-solute carrier family 23 (nucleobase transporters), member 1 Gene
PTXBC019225
New product
Data sheet of SLC23A1-solute carrier family 23 (nucleobase transporters), member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC23A1-solute carrier family 23 (nucleobase transporters), member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC019225 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC23A1 |
| Origin species: | Human |
| Product name: | SLC23A1-solute carrier family 23 (nucleobase transporters), member 1 Gene |
| Size: | 2ug |
| Accessions: | BC019225 |
| Gene id: | 9963 |
| Gene description: | solute carrier family 23 (nucleobase transporters), member 1 |
| Synonyms: | SLC23A2; SVCT1; YSPL3; solute carrier family 23 member 1; Na(+)/L-ascorbic acid transporter 1; hSVCT1; sodium-dependent vitamin C transporter-1; solute carrier family 23 (ascorbic acid transporter), member 1; solute carrier family 23 (nucleobase transporters), member 1; solute carrier family 23 (nucleobase transporters), member 2; yolk sac permease-like molecule 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagggcccaggaggacctcgagggccggacacagcatgaaaccaccagggacccctcgaccccgctacccacagagcctaagtttgacatgttgtacaagatcgaggacgtgccaccttggtacctgtgcatcctgctgggcttccagcactacctgacatgcttcagtggtaccatcgccgtgcccttcctgctggctgaggcgctgtgtgtgggccacgaccagcacatggttagtcagctcatcggcaccatcttcacgtgcgtgggcatgttctgcactctctttggcatgattacagctgtggggctgtccaacctgcaatttgtggacatgaactcctctcgcaacctcttcgtgctgggattttccatgttcttcgggctcacgctgcccaattacctggagtccaaccctggcgccatcaatacaggcattcttgaagtggatcagattctgattgtgctgctgaccacggagatgtttgtgggcgggtgccttgctttcatacttgacaacacagtgccagggagcccagaggagcgtggtctgatacagtggaaagctggggctcatgccaacagtgacatgtcttccagcctcaagagctacgatttccccattgggatgggcatagtaaaaagaattacctttctgaaatacattcctatctgcccagtcttcaaaggattttcttcaagttcaaaagatcagattgcaattccagaagacactccagaaaatacagaaactgcatctgtgtgcaccaaggtctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phosphoribosyl pyrophosphate synthetase-associated protein 1 - glutamate receptor, ionotropic, N-methyl D-aspartate-like 1A - serum deprivation response (phosphatidylserine binding protein) - NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa |