Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
DBI-diazepam binding inhibitor (GABA receptor modulator, acyl-Coenzyme A binding protein) Gene
PTXBC062996
New product
Data sheet of DBI-diazepam binding inhibitor (GABA receptor modulator, acyl-Coenzyme A binding protein) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DBI-diazepam binding inhibitor (GABA receptor modulator, acyl-Coenzyme A binding protein) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC062996 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DBI |
| Origin species: | Human |
| Product name: | DBI-diazepam binding inhibitor (GABA receptor modulator, acyl-Coenzyme A binding protein) Gene |
| Size: | 2ug |
| Accessions: | BC062996 |
| Gene id: | 1622 |
| Gene description: | diazepam binding inhibitor (GABA receptor modulator, acyl-Coenzyme A binding protein) |
| Synonyms: | ACBD1; ACBP; CCK-RP; acyl-CoA-binding protein; GABA receptor modulator; acyl coenzyme A binding protein; acyl-Coenzyme A binding domain containing 1; cholecystokinin-releasing peptide, trypsin-sensitive; diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein); diazepam binding inhibitor (GABA receptor modulator, acyl-Coenzyme A binding protein); diazepam-binding inhibitor; endozepine; diazepam binding inhibitor, acyl-CoA binding protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtggggcgacctctggctcctcccgcctgcctctgccaatccgggcactgggacagaggctgagtttgagaaagctgcagaggaggttaggcaccttaagaccaagccatcggatgaggagatgctgttcatctatggccactacaaacaagcaactgtgggcgacataaatacagaacggcccgggatgttggacttcacgggcaaggccaagtgggatgcctggaatgagctgaaagggacttccaaggaagatgccatgaaagcttacatcaacaaagtagaagagctaaagaaaaaatacgggatatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - potassium large conductance calcium-activated channel, subfamily M, alpha member 1 - colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) - colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) - solute carrier family 39 (metal ion transporter), member 11 |