Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
FIS1-fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae) Gene
PTXBC003540
New product
Data sheet of FIS1-fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FIS1-fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003540 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FIS1 |
| Origin species: | Human |
| Product name: | FIS1-fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC003540 |
| Gene id: | 51024 |
| Gene description: | fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae) |
| Synonyms: | FIS1 homolog; CGI-135; TTC11; mitochondrial fission 1 protein; H_NH0132A01.6; TPR repeat protein 11; fission 1 (mitochondrial outer membrane) homolog; hFis1; mitochondrial fission molecule; tetratricopeptide repeat domain 11; tetratricopeptide repeat protein 11; fission, mitochondrial 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggccgtgctgaacgagctggtgtctgtggaggacctgctgaagtttgaaaagaaatttcagtctgagaaggcagcaggctcggtgtccaagagcacgcagtttgagtacgcctggtgcctggtgcggagcaagtacaatgatgacatccgtaaaggcatcgtgctgctcgaggagctgctgcccaaagggagcaaggaggaacagcgggattacgtcttctacctggccgtggggaactaccggctcaaggaatacgagaaggccttaaagtacgtccgcgggttgctgcagacagagccccagaacaaccaggccaaggaactggagcggctcattgacaaggccatgaagaaagatggactcgtgggcatggccatcgtgggaggcatggccctgggtgtggcgggactggccggactcatcggacttgctgtgtccaagtccaaatcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase) - transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila) - protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b - diazepam binding inhibitor (GABA receptor modulator, acyl-Coenzyme A binding protein) |