Login to display prices
Login to display prices
FIS1-fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae) Gene View larger

FIS1-fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae) Gene

PTXBC003540

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FIS1-fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FIS1-fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae) Gene

Proteogenix catalog: PTXBC003540
Ncbi symbol: FIS1
Product name: FIS1-fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC003540
Gene id: 51024
Gene description: fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae)
Synonyms: FIS1 homolog; CGI-135; TTC11; mitochondrial fission 1 protein; H_NH0132A01.6; TPR repeat protein 11; fission 1 (mitochondrial outer membrane) homolog; hFis1; mitochondrial fission molecule; tetratricopeptide repeat domain 11; tetratricopeptide repeat protein 11; fission, mitochondrial 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggccgtgctgaacgagctggtgtctgtggaggacctgctgaagtttgaaaagaaatttcagtctgagaaggcagcaggctcggtgtccaagagcacgcagtttgagtacgcctggtgcctggtgcggagcaagtacaatgatgacatccgtaaaggcatcgtgctgctcgaggagctgctgcccaaagggagcaaggaggaacagcgggattacgtcttctacctggccgtggggaactaccggctcaaggaatacgagaaggccttaaagtacgtccgcgggttgctgcagacagagccccagaacaaccaggccaaggaactggagcggctcattgacaaggccatgaagaaagatggactcgtgggcatggccatcgtgggaggcatggccctgggtgtggcgggactggccggactcatcggacttgctgtgtccaagtccaaatcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: