FIS1-fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae) Gene View larger

FIS1-fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FIS1-fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FIS1-fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003540
Product type: DNA & cDNA
Ncbi symbol: FIS1
Origin species: Human
Product name: FIS1-fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC003540
Gene id: 51024
Gene description: fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae)
Synonyms: FIS1 homolog; CGI-135; TTC11; mitochondrial fission 1 protein; H_NH0132A01.6; TPR repeat protein 11; fission 1 (mitochondrial outer membrane) homolog; hFis1; mitochondrial fission molecule; tetratricopeptide repeat domain 11; tetratricopeptide repeat protein 11; fission, mitochondrial 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggccgtgctgaacgagctggtgtctgtggaggacctgctgaagtttgaaaagaaatttcagtctgagaaggcagcaggctcggtgtccaagagcacgcagtttgagtacgcctggtgcctggtgcggagcaagtacaatgatgacatccgtaaaggcatcgtgctgctcgaggagctgctgcccaaagggagcaaggaggaacagcgggattacgtcttctacctggccgtggggaactaccggctcaaggaatacgagaaggccttaaagtacgtccgcgggttgctgcagacagagccccagaacaaccaggccaaggaactggagcggctcattgacaaggccatgaagaaagatggactcgtgggcatggccatcgtgggaggcatggccctgggtgtggcgggactggccggactcatcggacttgctgtgtccaagtccaaatcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase)
- transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila)
- protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b
- diazepam binding inhibitor (GABA receptor modulator, acyl-Coenzyme A binding protein)

Buy FIS1-fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae) Gene now

Add to cart