RMND1-required for meiotic nuclear division 1 homolog (S. cerevisiae) Gene View larger

RMND1-required for meiotic nuclear division 1 homolog (S. cerevisiae) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RMND1-required for meiotic nuclear division 1 homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RMND1-required for meiotic nuclear division 1 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012081
Product type: DNA & cDNA
Ncbi symbol: RMND1
Origin species: Human
Product name: RMND1-required for meiotic nuclear division 1 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC012081
Gene id: 55005
Gene description: required for meiotic nuclear division 1 homolog (S. cerevisiae)
Synonyms: C6orf96; COXPD11; RMD1; bA351K16; bA351K16.3; required for meiotic nuclear division protein 1 homolog; required for meiotic nuclear division 1 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccagccacactcctcagagccgtggccagatctcatcatatattatcaaaagcacatcagtgccgaagaatcggtcatctaatgttaaaaccacttaaggaatttgaaaatacaacatgcagcacactgacaatacgtcaaagcttggatttgttccttcctgataaaacagctagtggtttgaataagtctcagatcctggaaatgaaccaaaaaaagtcagataccagcatgctgtctccattaaatgctgctcgttgccaagatgaaaaggcacaccttccaaccatgaaatcctttggtactcacaggagagtgacccacaaaccaaatctgttgggttctaaatggtttataaaaatattaaagaggcatttctcatctgtatcaacggaaacatttgttccaaaacaagacttcccacaggtgaagagaccactaaaagcatccaggaccagacagccatccaggaccaaccttccagttctgtctgtgaacgaggacctaatgcactgcacagcatttgcaacggcagatgagtatcatctgggaaatctgtctcaagatctggcctcccacggatatgttgaagtaacaagcttgcctagaggtacttcttcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)
- proteasome (prosome, macropain) activator subunit 2 (PA28 beta)
- MIT, microtubule interacting and transport, domain containing 1
- endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1

Buy RMND1-required for meiotic nuclear division 1 homolog (S. cerevisiae) Gene now

Add to cart