Login to display prices
Login to display prices
PRPF40A-PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae) Gene View larger

PRPF40A-PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PRPF40A-PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PRPF40A-PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC027178
Product type: DNA & cDNA
Ncbi symbol: PRPF40A
Origin species: Human
Product name: PRPF40A-PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae) Gene
Size: 2ug
Accessions: BC027178
Gene id: 55660
Gene description: PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)
Synonyms: FBP-11; FBP11; FLAF1; FNBP3; HIP-10; HIP10; HYPA; NY-REN-6; Prp40; pre-mRNA-processing factor 40 homolog A; Fas-ligand associated factor 1; Huntingtin-interacting protein A; NY-REN-6 antigen; PRP40 pre-mRNA processing factor 40 homolog A; fas ligand-associated factor 1; formin binding protein 3; formin-binding protein 11; huntingtin yeast partner A; huntingtin-interacting protein 10; renal carcinoma antigen NY-REN-6; pre-mRNA processing factor 40 homolog A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaacgaaaagaatctgcatttaagagtatgttaaaacaagctgctcctccgatagaattggatgctgtctgggaagatatccgtgagagatttgtaaaagagccagcatttgaggacataactctagaatctgaaagaaaacgaatatttaaagattttatgcatgtgcttgagcatgaatgtcagcatcatcattcaaagaacaagaaacattctaagaaatctaaaaaacatcataggaaacgttcccgctctcgatcggggtcagattcagatgatgatgatagccattcaaagaaaaaaagacagcgatcagagtctcgttctgcttcagaacattcttctagtgcagagtctgagagaagttataaaaagtcaaaaaagcataagaagaaaagtaagaagaggagacataaatctgactctccagaatccgatgctgagcgagagaaggataaaaaagaaaaagatcgggaaagtgaaaaagacagaactagacaaagatcagaatcaaaacacaaatcgcctaagaaaaagactggaaaggattctggtaattgggatacttctggcagcgaactgagtgaaggggaattggaaaagcgcagaagaacccttttggagcaactggatgatgatcaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - proteasome (prosome, macropain) activator subunit 2 (PA28 beta)
- MIT, microtubule interacting and transport, domain containing 1
- endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1
- tumor necrosis factor receptor superfamily, member 6b, decoy