> >>TNFRSF6B-tumor necrosis factor receptor superfamily, member 6b, decoy Gene
TNFRSF6B-tumor necrosis factor receptor superfamily, member 6b, decoy Gene View larger

TNFRSF6B-tumor necrosis factor receptor superfamily, member 6b, decoy Gene

PTXBC017065

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of TNFRSF6B-tumor necrosis factor receptor superfamily, member 6b, decoy Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TNFRSF6B-tumor necrosis factor receptor superfamily, member 6b, decoy Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017065
Product type: DNA & cDNA
Ncbi symbol: TNFRSF6B
Origin species: Human
Product name: TNFRSF6B-tumor necrosis factor receptor superfamily, member 6b, decoy Gene
Size: 2ug
Accessions: BC017065
Gene id: 8771
Gene description: tumor necrosis factor receptor superfamily, member 6b, decoy
Synonyms: DCR3; DJ583P15.1.1; M68; M68E; TR6; tumor necrosis factor receptor superfamily member 6B; decoy receptor 3 variant 1; decoy receptor 3 variant 2; decoy receptor for Fas ligand; tumor necrosis factor receptor superfamily, member 6b, decoy; TNF receptor superfamily member 6b
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagggcgctggaggggccaggcctgtcgctgctgtgcctggtgttggcgctgcctgccctgctgccggtgccggctgtacgcggagtggcagaaacacccacctacccctggcgggacgcagagacaggggagcggctggtgtgcgcccagtgccccccaggcacctttgtgcagcggccgtgccgccgagacagccccacgacgtgtggcccgtgtccaccgcgccactacacgcagttctggaactacctggagcgctgccgctactgcaacgtcctctgcggggagcgtgaggaggaggcacgggcttgccacgccacccacaaccgtgcctgccgctgccgcaccggcttcttcgcgcacgctggtttctgcttggagcacgcatcgtgtccacctggtgccggcgtgattgccccgggcacccccagccagaacacgcagtgccagccgtgccccccaggcaccttctcagccagcagctccagctcagagcagtgccagccccaccgcaactgcacggccctgggcctggccctcaatgtgccaggctcttcctcccatgacaccctgtgcaccagctgcactggcttccccctcagcaccagggtaccaggagctgaggagtgtgagcgtgccgtcatcgactttgtggctttccaggacatctccatcaagaggctgcagcggctgctgcaggccctcgaggccccggagggctggggtccgacaccaagggcgggccgcgcggccttgcagctgaagctgcgtcggcggctcacggagctcctgggggcgcaggacggggcgctgctggtgcggctgctgcaggcgctgcgcgtggccaggatgcccgggctggagcggagcgtccgtgagcgcttcctccctgtgcactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - vesicle amine transport protein 1 homolog (T. californica)-like
- translocase of inner mitochondrial membrane 44 homolog (yeast)
- amyloid beta (A4) precursor protein-binding, family B, member 3
- transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)

Reviews

Buy TNFRSF6B-tumor necrosis factor receptor superfamily, member 6b, decoy Gene now

Add to cart