Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
VAT1L-vesicle amine transport protein 1 homolog (T. californica)-like Gene
PTXBC033537
New product
Data sheet of VAT1L-vesicle amine transport protein 1 homolog (T. californica)-like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about VAT1L-vesicle amine transport protein 1 homolog (T. californica)-like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC033537 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | VAT1L |
| Origin species: | Human |
| Product name: | VAT1L-vesicle amine transport protein 1 homolog (T. californica)-like Gene |
| Size: | 2ug |
| Accessions: | BC033537 |
| Gene id: | 57687 |
| Gene description: | vesicle amine transport protein 1 homolog (T. californica)-like |
| Synonyms: | synaptic vesicle membrane protein VAT-1 homolog-like; vesicle amine transport protein 1 homolog (T. californica)-like; vesicle amine transport protein 1 homolog-like (T. californica); vesicle amine transport 1 like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccaaggaaggcgtggagaaggcggaggagacggagcaaatgatcgagaaggaggcaggcaaggagccggcggagggcggcggcggcgacggctcgcaccgcctcggggacgcccaggagatgcgcgcggtggtgctggctggcttcggggggctcaacaagctgcggctcttcaggaaggccatgcccgagcctcaggacggcgagctcaagatccgcgtcaaagcctgtggattaaacttcattgacttgatggtgcgacaagggaatattgacaaccctcccaagactcccctggtgccaggatttgagtgttctgggattgttgaagctctgggggacagcgtgaaaggatatgagattggagaccgtgtcatggcatttgtcaattacaatgcctgggcagaggtggtctgcacaccagtggagtttgtctacaagatcccggatgacatgagcttctcggaggctgctgcattccccatgaacttcgtcacagcctatgtgatgctgtttgaagttgccaacctccgggaagggatgtctgtgctcgtgcactcagctggtgggggcgtgggtcaagctgtggctcagctgtgttccactgtccccaacgtgactgtctttggaacagcctctactttcaagcatgaagcaatcaaagactctgtgacccacctctttgacagaaatgcagactacgtgcaagaagttaaaagaatctctgctgaaggtgtggacatcgttttggattgcctctgtggggacaacactggaaaaggtctcagtcttctcaaacccctgggaacctacattttatatggctcatccaacatggtaactggagagaccaagagcttcttcagctttgcaaaatcatggtggcaggtggagaaggtgaaccccatcaagctgtatgaggagaacaaagtcatcgcggggttttcccttttaaatctgctcttcaaacaaggccgggcgggcctcattcggggagtggtggaaaaactcatagggctctacaaccagaagaagatcaagcctgtggtggactccttgtgggctctggaggaggtgaaggaggccatgcagcggattcacgaccgagggaacattggcaagttaattctggatgtagaaaagaccccaactccactgatggccaatgacagcacagagaccagtgaagcaggggaagaggaggaggaccacgagggagacagcgagaacaaggagcggatgccctttatccagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - translocase of inner mitochondrial membrane 44 homolog (yeast) - amyloid beta (A4) precursor protein-binding, family B, member 3 - transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila) - UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast) |