Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ERGIC1-endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 Gene
PTXBC012766
New product
Data sheet of ERGIC1-endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ERGIC1-endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012766 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ERGIC1 |
| Origin species: | Human |
| Product name: | ERGIC1-endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 Gene |
| Size: | 2ug |
| Accessions: | BC012766 |
| Gene id: | 57222 |
| Gene description: | endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 |
| Synonyms: | ERGIC-32; ERGIC32; NET24; endoplasmic reticulum-Golgi intermediate compartment protein 1; ER-Golgi intermediate compartment 32 kDa protein; endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1; endoplasmic reticulum-golgi intermediate compartment 32 kDa protein; endoplasmic reticulum-golgi intermediate compartment 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccctttgacttcaggaggtttgacatctacaggaaggtgcccaaggaccttacgcagccaacgtacaccggggccattatctccatctgctgctgcctcttcatcctcttcctcttcctctcggagctcaccggatttataacgacagaagttgtgaacgagctctatgtcgatgacccagacaaggacagcggtggcaagatcgacgtcagtctgaacatcagtttacccaatctgcactgcgagttggttgggcttgacattcaggatgagatgggcaggcacgaagtgggccacatcgacaactccatgaagatcccgctgaacaatggggcaggctgccgcttcgaggggcagttcagcatcaacaaggtccccggcaacttccacgtgtccacacacagtgccacagcccagccacagaacccagacatgacgcatgtcatccacaagctctcctttggggacacgctacaggtccagaacatccacggagctttcaatgctctcgggggagcagacagactcacctccaaccccctggcctcccacgactacatcctgaagattgtgcccacggtttatgaggacaagagtggcaagcagcggtactcctaccagtacacggtggccaacaaggaatacgtcgcctacagccacacgggccgcatcatccctgcaatctggttccgctacgacctcagccccatcacggtcaagtacacagagagacggcagccgctgtacagattcatcaccacgatctgtgccatcattggcgggaccttcaccgtcgccggcatcctggactcatgcatcttcacagcctctgaggcctggaagaagatccagctgggcaagatgcattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tumor necrosis factor receptor superfamily, member 6b, decoy - vesicle amine transport protein 1 homolog (T. californica)-like - translocase of inner mitochondrial membrane 44 homolog (yeast) - amyloid beta (A4) precursor protein-binding, family B, member 3 |