ERGIC1-endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 Gene View larger

ERGIC1-endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 Gene

PTXBC012766

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ERGIC1-endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ERGIC1-endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012766
Product type: DNA & cDNA
Ncbi symbol: ERGIC1
Origin species: Human
Product name: ERGIC1-endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 Gene
Size: 2ug
Accessions: BC012766
Gene id: 57222
Gene description: endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1
Synonyms: ERGIC-32; ERGIC32; NET24; endoplasmic reticulum-Golgi intermediate compartment protein 1; ER-Golgi intermediate compartment 32 kDa protein; endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1; endoplasmic reticulum-golgi intermediate compartment 32 kDa protein; endoplasmic reticulum-golgi intermediate compartment 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccctttgacttcaggaggtttgacatctacaggaaggtgcccaaggaccttacgcagccaacgtacaccggggccattatctccatctgctgctgcctcttcatcctcttcctcttcctctcggagctcaccggatttataacgacagaagttgtgaacgagctctatgtcgatgacccagacaaggacagcggtggcaagatcgacgtcagtctgaacatcagtttacccaatctgcactgcgagttggttgggcttgacattcaggatgagatgggcaggcacgaagtgggccacatcgacaactccatgaagatcccgctgaacaatggggcaggctgccgcttcgaggggcagttcagcatcaacaaggtccccggcaacttccacgtgtccacacacagtgccacagcccagccacagaacccagacatgacgcatgtcatccacaagctctcctttggggacacgctacaggtccagaacatccacggagctttcaatgctctcgggggagcagacagactcacctccaaccccctggcctcccacgactacatcctgaagattgtgcccacggtttatgaggacaagagtggcaagcagcggtactcctaccagtacacggtggccaacaaggaatacgtcgcctacagccacacgggccgcatcatccctgcaatctggttccgctacgacctcagccccatcacggtcaagtacacagagagacggcagccgctgtacagattcatcaccacgatctgtgccatcattggcgggaccttcaccgtcgccggcatcctggactcatgcatcttcacagcctctgaggcctggaagaagatccagctgggcaagatgcattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tumor necrosis factor receptor superfamily, member 6b, decoy
- vesicle amine transport protein 1 homolog (T. californica)-like
- translocase of inner mitochondrial membrane 44 homolog (yeast)
- amyloid beta (A4) precursor protein-binding, family B, member 3

Buy ERGIC1-endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 Gene now

Add to cart