Login to display prices
Login to display prices
ERGIC1-endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 Gene View larger

ERGIC1-endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 Gene

PTXBC012766

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ERGIC1-endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ERGIC1-endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 Gene

Proteogenix catalog: PTXBC012766
Ncbi symbol: ERGIC1
Product name: ERGIC1-endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 Gene
Size: 2ug
Accessions: BC012766
Gene id: 57222
Gene description: endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1
Synonyms: ERGIC-32; ERGIC32; NET24; endoplasmic reticulum-Golgi intermediate compartment protein 1; ER-Golgi intermediate compartment 32 kDa protein; endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1; endoplasmic reticulum-golgi intermediate compartment 32 kDa protein; endoplasmic reticulum-golgi intermediate compartment 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccctttgacttcaggaggtttgacatctacaggaaggtgcccaaggaccttacgcagccaacgtacaccggggccattatctccatctgctgctgcctcttcatcctcttcctcttcctctcggagctcaccggatttataacgacagaagttgtgaacgagctctatgtcgatgacccagacaaggacagcggtggcaagatcgacgtcagtctgaacatcagtttacccaatctgcactgcgagttggttgggcttgacattcaggatgagatgggcaggcacgaagtgggccacatcgacaactccatgaagatcccgctgaacaatggggcaggctgccgcttcgaggggcagttcagcatcaacaaggtccccggcaacttccacgtgtccacacacagtgccacagcccagccacagaacccagacatgacgcatgtcatccacaagctctcctttggggacacgctacaggtccagaacatccacggagctttcaatgctctcgggggagcagacagactcacctccaaccccctggcctcccacgactacatcctgaagattgtgcccacggtttatgaggacaagagtggcaagcagcggtactcctaccagtacacggtggccaacaaggaatacgtcgcctacagccacacgggccgcatcatccctgcaatctggttccgctacgacctcagccccatcacggtcaagtacacagagagacggcagccgctgtacagattcatcaccacgatctgtgccatcattggcgggaccttcaccgtcgccggcatcctggactcatgcatcttcacagcctctgaggcctggaagaagatccagctgggcaagatgcattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: