Login to display prices
Login to display prices
MAFG-v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian) Gene View larger

MAFG-v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian) Gene

PTXBC012327

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAFG-v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MAFG-v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian) Gene

Proteogenix catalog: PTXBC012327
Ncbi symbol: MAFG
Product name: MAFG-v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian) Gene
Size: 2ug
Accessions: BC012327
Gene id: 4097
Gene description: v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian)
Synonyms: basic leucine zipper transcription factor MafG; transcription factor MafG; hMAF; v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog G; MAF bZIP transcription factor G
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacgacccccaataaaggaaacaaggccttgaaggtgaagcgggagccgggtgagaatggcaccagcctgacggatgaggagctggtgaccatgtcggtgcgggagctgaaccagcacctgcggggcctgtccaaggaggagatcgtccagctgaagcagcgccggcgcacgctcaagaaccgcggctacgctgccagctgccgcgtgaagcgggtgacgcagaaggaggagctggagaagcagaaggcggagctgcagcaggaggtggagaagctggcctcagagaacgccagcatgaagctggagctcgacgcgctgcgctccaagtacgaggcgctgcagaccttcgcccggacggtggcccgcagccccgtggcgccagcccggggcccccttgccgccggcctggggcccctcgtcccaggcaaggtggccgccaccagcgtcatcacaatagtaaagtccaagacggatgcccgatcgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice