Login to display prices
Login to display prices
ITPA-inosine triphosphatase (nucleoside triphosphate pyrophosphatase) Gene View larger

ITPA-inosine triphosphatase (nucleoside triphosphate pyrophosphatase) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ITPA-inosine triphosphatase (nucleoside triphosphate pyrophosphatase) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ITPA-inosine triphosphatase (nucleoside triphosphate pyrophosphatase) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010138
Product type: DNA & cDNA
Ncbi symbol: ITPA
Origin species: Human
Product name: ITPA-inosine triphosphatase (nucleoside triphosphate pyrophosphatase) Gene
Size: 2ug
Accessions: BC010138
Gene id: 3704
Gene description: inosine triphosphatase (nucleoside triphosphate pyrophosphatase)
Synonyms: C20orf37; HLC14-06-P; ITPase; My049; NTPase; dJ794I6.3; inosine triphosphate pyrophosphatase; inosine triphosphatase (nucleoside triphosphate pyrophosphatase); inosine triphosphate pyrophosphohydrolase; non-canonical purine NTP pyrophosphatase; non-standard purine NTP pyrophosphatase; nucleoside-triphosphate diphosphatase; inosine triphosphatase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcctcattggtggggaagaagatcgtgtttgtaacggggaacgccaagaagctggaggaggtcgttcagattctaggagataagtttccatgcactttggtggcacagaaaattgacctgccggagtaccagggggagccggatgagatttccatacagaaatgtcaggaggcagttcgccaggtacaggggcccgtgctggttgaggacacttgtctgtgcttcaatgcccttggagggctccccggcccctacataaagtggtttctggagaagttaaagcctgaaggtctccaccagctcctggccgggttcgaggacaagtcagcctatgcgctctgcacgtttgcactcagcaccggggacccaagccagcccgtgcgcctgttcaggggccggacctcgggccggatcgtggcacccagaggctgccaggactttggctgggacccctgctttcagcctgatggatatgagcagacgtacgcagagatgcctaaggcggagaagaacgctgtctcccatcgcttccgggccctgctggagctgcaggagtactttggcagtttggcagcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - required for meiotic nuclear division 1 homolog (S. cerevisiae)
- PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)
- proteasome (prosome, macropain) activator subunit 2 (PA28 beta)
- MIT, microtubule interacting and transport, domain containing 1