Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SSU72-SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) Gene
PTXBC008070
New product
Data sheet of SSU72-SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SSU72-SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008070 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SSU72 |
| Origin species: | Human |
| Product name: | SSU72-SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC008070 |
| Gene id: | 29101 |
| Gene description: | SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) |
| Synonyms: | SSU72 homolog, RNA polymerase II CTD phosphatase; CTD phosphatase SSU72; RNA polymerase II subunit A C-terminal domain phosphatase SSU72; HSPC182; PNAS-120 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccgtcgtccccgctgcgggtggcggtggtgtgctcgagcaaccagaaccggagcatggaggcgcacaacatcctcagcaaacggggattcagcgtccgatcctttggaacagggactcacgtgaagcttccaggaccagctcccgacaagcccaatgtttatgatttcaaaaccacatatgaccagatgtacaatgatcttcttaggaaagacaaagaactctatacacagaatgggattttacatatgctggacagaaataagagaatcaagccccggccagaaagattccagaactgcaaagacctgtttgatctgatcctcacttgcgaagagagagtgtatgaccaggtggtggaagatctgaattccagagaacaggagacctgccagcccgtgcacgtggtcaatgtggacatccaggacaaccacgaggaggccaccctgggggcgtttctcatctgtgagctctgccagtgtatccagcacacggaagacatggagaacgagatcgacgagctgctgcaggagttcgaggagaagagtggccgcacctttctgcacaccgtctgcttctactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - inosine triphosphatase (nucleoside triphosphate pyrophosphatase) - required for meiotic nuclear division 1 homolog (S. cerevisiae) - PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae) - proteasome (prosome, macropain) activator subunit 2 (PA28 beta) |