Login to display prices
Login to display prices
SSU72-SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) Gene View larger

SSU72-SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) Gene

PTXBC008070

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SSU72-SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SSU72-SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) Gene

Proteogenix catalog: PTXBC008070
Ncbi symbol: SSU72
Product name: SSU72-SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC008070
Gene id: 29101
Gene description: SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae)
Synonyms: SSU72 homolog, RNA polymerase II CTD phosphatase; CTD phosphatase SSU72; RNA polymerase II subunit A C-terminal domain phosphatase SSU72; HSPC182; PNAS-120
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgtcgtccccgctgcgggtggcggtggtgtgctcgagcaaccagaaccggagcatggaggcgcacaacatcctcagcaaacggggattcagcgtccgatcctttggaacagggactcacgtgaagcttccaggaccagctcccgacaagcccaatgtttatgatttcaaaaccacatatgaccagatgtacaatgatcttcttaggaaagacaaagaactctatacacagaatgggattttacatatgctggacagaaataagagaatcaagccccggccagaaagattccagaactgcaaagacctgtttgatctgatcctcacttgcgaagagagagtgtatgaccaggtggtggaagatctgaattccagagaacaggagacctgccagcccgtgcacgtggtcaatgtggacatccaggacaaccacgaggaggccaccctgggggcgtttctcatctgtgagctctgccagtgtatccagcacacggaagacatggagaacgagatcgacgagctgctgcaggagttcgaggagaagagtggccgcacctttctgcacaccgtctgcttctactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice