Cart 1 Product Products 113,40 € (empty)
-
1 x RSPO2-R-sp...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
Data sheet of C3orf60-chromosome 3 open reading frame 60 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C3orf60-chromosome 3 open reading frame 60 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002873 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C3orf60 |
| Origin species: | Human |
| Product name: | C3orf60-chromosome 3 open reading frame 60 Gene |
| Size: | 2ug |
| Accessions: | BC002873 |
| Gene id: | 25915 |
| Gene description: | chromosome 3 open reading frame 60 |
| Synonyms: | C3orf60; 2P1; E3-3; NADH dehydrogenase [ubiquinone] 1 alpha subcomplex assembly factor 3; NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 3; NADH dehydrogenase (ubiquinone) complex I, assembly factor 3; nuclear protein E3-3; NADH:ubiquinone oxidoreductase complex assembly factor 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccaccgctctcgcgctacgtagcttgtaccgagcgcgaccctcgctgcgctgtccgcccgttgagcttccctgggccccgcggcgagggcatcggctctcgccggcggatgacgagctgtatcagcggacgcgcatctctctgctgcaacgcgaggccgctcaggcaatgtacatcgacagctacaacagccgcggcttcatgataaacggaaaccgcgtgctcggcccctgcgctctgctcccgcactcggtggtgcagtggaacgtgggatcccaccaggacatcaccgaagacagcttttccctcttctggttgctggagccccggatagagatcgtggtggtggggactggagaccggaccgagaggctgcagtcccaggtgcttcaagccatgaggcagcggggcattgctgtggaagtgcaggacacgcccaatgcctgtgccaccttcaacttcctgtgtcatgaaggccgagtaactggagctgctctcatccctccaccaggagggacttcacttacatctttgggccaagctgctcaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RAP1B, member of RAS oncogene family - mitochondrial ribosomal protein S28 - chromosome 7 open reading frame 50 - golgi SNAP receptor complex member 2 |