Login to display prices
Login to display prices
C3orf60-chromosome 3 open reading frame 60 Gene View larger

C3orf60-chromosome 3 open reading frame 60 Gene

PTXBC002873

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C3orf60-chromosome 3 open reading frame 60 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C3orf60-chromosome 3 open reading frame 60 Gene

Proteogenix catalog: PTXBC002873
Ncbi symbol: C3orf60
Product name: C3orf60-chromosome 3 open reading frame 60 Gene
Size: 2ug
Accessions: BC002873
Gene id: 25915
Gene description: chromosome 3 open reading frame 60
Synonyms: C3orf60; 2P1; E3-3; NADH dehydrogenase [ubiquinone] 1 alpha subcomplex assembly factor 3; NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 3; NADH dehydrogenase (ubiquinone) complex I, assembly factor 3; nuclear protein E3-3; NADH:ubiquinone oxidoreductase complex assembly factor 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccaccgctctcgcgctacgtagcttgtaccgagcgcgaccctcgctgcgctgtccgcccgttgagcttccctgggccccgcggcgagggcatcggctctcgccggcggatgacgagctgtatcagcggacgcgcatctctctgctgcaacgcgaggccgctcaggcaatgtacatcgacagctacaacagccgcggcttcatgataaacggaaaccgcgtgctcggcccctgcgctctgctcccgcactcggtggtgcagtggaacgtgggatcccaccaggacatcaccgaagacagcttttccctcttctggttgctggagccccggatagagatcgtggtggtggggactggagaccggaccgagaggctgcagtcccaggtgcttcaagccatgaggcagcggggcattgctgtggaagtgcaggacacgcccaatgcctgtgccaccttcaacttcctgtgtcatgaaggccgagtaactggagctgctctcatccctccaccaggagggacttcacttacatctttgggccaagctgctcaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice