RAP1B-RAP1B, member of RAS oncogene family Gene View larger

RAP1B-RAP1B, member of RAS oncogene family Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAP1B-RAP1B, member of RAS oncogene family Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RAP1B-RAP1B, member of RAS oncogene family Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000176
Product type: DNA & cDNA
Ncbi symbol: RAP1B
Origin species: Human
Product name: RAP1B-RAP1B, member of RAS oncogene family Gene
Size: 2ug
Accessions: BC000176
Gene id: 5908
Gene description: RAP1B, member of RAS oncogene family
Synonyms: RAP1B, member of RAS oncogene family; Ras family small GTP binding protein RAP1B; RAS-related protein RAP1B; K-REV; RAL1B; ras-related protein Rap-1b; GTP-binding protein smg p21B; small GTP binding protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgtgagtataagctagtcgttcttggctcaggaggcgttggaaagtctgctttgactgtacaatttgttcaaggaatttttgtagaaaaatacgatcctacgatagaagattcttatagaaagcaagttgaagtagatgcacaacagtgtatgcttgaaatcttggatactgcaggaacggagcaatttacagcaatgagggatttatacatgaaaaatggacaaggatttgcattagtttattccatcacagcacagtccacatttaacgatttacaagacctgagagaacagattcttcgagttaaagacactgatgatgttccaatgattcttgttggtaataagtgtgacttggaagatgaaagagttgtagggaaggaacaaggtcaaaatctagcaagacaatggaacaactgtgcattcttagaatcttctgcaaaatcaaaaataaatgttaatgagatcttttatgacctagtgcggcaaattaacagaaaaactccagtgcctgggaaggctcgcaaaaagtcatcatgtcagctgctttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitochondrial ribosomal protein S28
- chromosome 7 open reading frame 50
- golgi SNAP receptor complex member 2
- integrin beta 1 binding protein 1

Buy RAP1B-RAP1B, member of RAS oncogene family Gene now

Add to cart