Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RAP1B-RAP1B, member of RAS oncogene family Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RAP1B-RAP1B, member of RAS oncogene family Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000176 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RAP1B |
| Origin species: | Human |
| Product name: | RAP1B-RAP1B, member of RAS oncogene family Gene |
| Size: | 2ug |
| Accessions: | BC000176 |
| Gene id: | 5908 |
| Gene description: | RAP1B, member of RAS oncogene family |
| Synonyms: | RAP1B, member of RAS oncogene family; Ras family small GTP binding protein RAP1B; RAS-related protein RAP1B; K-REV; RAL1B; ras-related protein Rap-1b; GTP-binding protein smg p21B; small GTP binding protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcgtgagtataagctagtcgttcttggctcaggaggcgttggaaagtctgctttgactgtacaatttgttcaaggaatttttgtagaaaaatacgatcctacgatagaagattcttatagaaagcaagttgaagtagatgcacaacagtgtatgcttgaaatcttggatactgcaggaacggagcaatttacagcaatgagggatttatacatgaaaaatggacaaggatttgcattagtttattccatcacagcacagtccacatttaacgatttacaagacctgagagaacagattcttcgagttaaagacactgatgatgttccaatgattcttgttggtaataagtgtgacttggaagatgaaagagttgtagggaaggaacaaggtcaaaatctagcaagacaatggaacaactgtgcattcttagaatcttctgcaaaatcaaaaataaatgttaatgagatcttttatgacctagtgcggcaaattaacagaaaaactccagtgcctgggaaggctcgcaaaaagtcatcatgtcagctgctttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - mitochondrial ribosomal protein S28 - chromosome 7 open reading frame 50 - golgi SNAP receptor complex member 2 - integrin beta 1 binding protein 1 |