C7orf50-chromosome 7 open reading frame 50 Gene View larger

C7orf50-chromosome 7 open reading frame 50 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C7orf50-chromosome 7 open reading frame 50 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C7orf50-chromosome 7 open reading frame 50 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006224
Product type: DNA & cDNA
Ncbi symbol: C7orf50
Origin species: Human
Product name: C7orf50-chromosome 7 open reading frame 50 Gene
Size: 2ug
Accessions: BC006224
Gene id: 84310
Gene description: chromosome 7 open reading frame 50
Synonyms: uncharacterized protein C7orf50; YCR016W; chromosome 7 open reading frame 50
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaaaacagaagagaaaagttcctgaagtgacagagaaaaagaacaaaaagctgaagaaggcgtcagcagaggggccactgctgggccctgaggctgcaccaagtggcgaaggagccggctccaagggcgaagctgtgctcaggcccgggctggacgcagagccagagctgtccccagaggagcagagggtcctggaaaggaagctgaaaaaggaacggaagaaagaggagaggcagcgtctgcgggaggcaggccttgtggcccagcacccgcctgccaggcgctcgggggccgaactggccctggactacctctgcagatgggcccaaaagcacaagaactggaggtttcagaagacgaggcagacgtggctcctgctgcacatgtatgacagtgacaaggttcccgatgagcacttctccaccctgctggcctacctggaggggctgcagggccgggcccgagagctgacggtgcagaaggcggaagccctgatgcgggagctggatgaggagggctctgatccccccctgccggggagggcccagcgcatccgacaggtgctgcagctgctctcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - golgi SNAP receptor complex member 2
- integrin beta 1 binding protein 1
- mitochondrial ribosomal protein S10
- chromosome 7 open reading frame 42

Buy C7orf50-chromosome 7 open reading frame 50 Gene now

Add to cart