Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of ITGB1BP1-integrin beta 1 binding protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ITGB1BP1-integrin beta 1 binding protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012264 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ITGB1BP1 |
| Origin species: | Human |
| Product name: | ITGB1BP1-integrin beta 1 binding protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC012264 |
| Gene id: | 9270 |
| Gene description: | integrin beta 1 binding protein 1 |
| Synonyms: | ICAP-1A; ICAP-1B; ICAP-1alpha; ICAP1; ICAP1A; ICAP1B; integrin beta-1-binding protein 1; bodenin; integrin cytoplasmic domain-associated protein 1; integrin cytoplasmic domain-associated protein 1-alpha; integrin cytoplasmic domain-associated protein 1-beta; integrin subunit beta 1 binding protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtttcgcaagggcaaaaaacgacacagtagtagcagttcccaaagtagcgaaatcagtactaagagcaagtctgtggattctagccttgggggtctttcacgatccagcactgtggccagcctcgacacagattccaccaaaagctcaggacaaagcaacaataattcagatacctgtgcagaatttcgaataaaatatgttggtgccattgagaaactgaaactctccgagggaaaaggccttgaagggccattagacctgataaattatatagacgttgcccagcaagatggaaagttgccttttgttcctccggaggaagaatttattatgggagtttccaagtatggcataaaagtatcaacatcagatcaatatgatgttttgcacaggcatgctctctacttaataatccggatggtgtgttacgatgacggtctgggggtgggaaaaagcttactggctctgaagaccacagatgcaagcaatgaggaatacagcctgtgggtttatcagtgcaacagcctggaacaagcacaagccatttgcaaggttttatccaccgcttttgactctgtattaacatctgagaaaccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - mitochondrial ribosomal protein S10 - chromosome 7 open reading frame 42 - mitochondrial ribosomal protein L22 - chromosome 5 open reading frame 30 |