ITGB1BP1-integrin beta 1 binding protein 1 Gene View larger

ITGB1BP1-integrin beta 1 binding protein 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ITGB1BP1-integrin beta 1 binding protein 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ITGB1BP1-integrin beta 1 binding protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012264
Product type: DNA & cDNA
Ncbi symbol: ITGB1BP1
Origin species: Human
Product name: ITGB1BP1-integrin beta 1 binding protein 1 Gene
Size: 2ug
Accessions: BC012264
Gene id: 9270
Gene description: integrin beta 1 binding protein 1
Synonyms: ICAP-1A; ICAP-1B; ICAP-1alpha; ICAP1; ICAP1A; ICAP1B; integrin beta-1-binding protein 1; bodenin; integrin cytoplasmic domain-associated protein 1; integrin cytoplasmic domain-associated protein 1-alpha; integrin cytoplasmic domain-associated protein 1-beta; integrin subunit beta 1 binding protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtttcgcaagggcaaaaaacgacacagtagtagcagttcccaaagtagcgaaatcagtactaagagcaagtctgtggattctagccttgggggtctttcacgatccagcactgtggccagcctcgacacagattccaccaaaagctcaggacaaagcaacaataattcagatacctgtgcagaatttcgaataaaatatgttggtgccattgagaaactgaaactctccgagggaaaaggccttgaagggccattagacctgataaattatatagacgttgcccagcaagatggaaagttgccttttgttcctccggaggaagaatttattatgggagtttccaagtatggcataaaagtatcaacatcagatcaatatgatgttttgcacaggcatgctctctacttaataatccggatggtgtgttacgatgacggtctgggggtgggaaaaagcttactggctctgaagaccacagatgcaagcaatgaggaatacagcctgtgggtttatcagtgcaacagcctggaacaagcacaagccatttgcaaggttttatccaccgcttttgactctgtattaacatctgagaaaccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitochondrial ribosomal protein S10
- chromosome 7 open reading frame 42
- mitochondrial ribosomal protein L22
- chromosome 5 open reading frame 30

Buy ITGB1BP1-integrin beta 1 binding protein 1 Gene now

Add to cart