MRPL22-mitochondrial ribosomal protein L22 Gene View larger

MRPL22-mitochondrial ribosomal protein L22 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPL22-mitochondrial ribosomal protein L22 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MRPL22-mitochondrial ribosomal protein L22 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012565
Product type: DNA & cDNA
Ncbi symbol: MRPL22
Origin species: Human
Product name: MRPL22-mitochondrial ribosomal protein L22 Gene
Size: 2ug
Accessions: BC012565
Gene id: 29093
Gene description: mitochondrial ribosomal protein L22
Synonyms: HSPC158; L22mt; MRP-L22; MRP-L25; RPML25; 39S ribosomal protein L22, mitochondrial; 39S ribosomal protein L25, mitochondrial; L25mt; mitochondrial ribosomal protein L22
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcggcagtactgggacagttgggtgcgttatggatacataacctgaggagccgggggaagctggccttgggtgttttacctcaatcatatatccacacaagtgcttctcttgacatttctcgaaaatgggagaagaagaataaaattgtttatcctccacaactgcctggagaacctcggagaccagcagaaatctaccactgtcgaagacaaataaaatatagcaaagacaagatgtggtatttggcaaaattgatacgaggaatgtctattgaccaggctttggctcagttggaattcaatgacaaaaaaggggccaaaataattaaagaggttctcttagaagcacaagatatggcagtgagagaccataacgtggaattcaggtccaatttatatatagctgagtccacctcaggacgaggccagtgcctgaaacgcatccgctaccatggcagaggtcgctttgggatcatggagaaggtttattgccattattttgtgaagttggtggaagggcccccacctccacctgagccaccaaagacggcagttgcccatgccaaagagtatattcagcagcttcgcagccggaccatcgttcacactctatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 5 open reading frame 30
- mitochondrial ribosomal protein L40
- immature colon carcinoma transcript 1
- chromosome 7 open reading frame 61

Buy MRPL22-mitochondrial ribosomal protein L22 Gene now

Add to cart