ICT1-immature colon carcinoma transcript 1 Gene View larger

ICT1-immature colon carcinoma transcript 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ICT1-immature colon carcinoma transcript 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ICT1-immature colon carcinoma transcript 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015335
Product type: DNA & cDNA
Ncbi symbol: ICT1
Origin species: Human
Product name: ICT1-immature colon carcinoma transcript 1 Gene
Size: 2ug
Accessions: BC015335
Gene id: 3396
Gene description: immature colon carcinoma transcript 1
Synonyms: peptidyl-tRNA hydrolase ICT1, mitochondrial; ICT1; DS-1; DS1; MRP-L58; 39S ribosomal protein L58, mitochondrial; digestion substraction 1; immature colon carcinoma transcript 1 protein; mitochondrial ribosomal protein L58
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggccaccaggtgcctgcgctggggcctgagccgagccggagtctggctgctcccaccgcccgcacggtgcccacgccgggcgctgcacaagcagaaagacggcactgagttcaagagcatctacagcctggacaagctctaccccgaatctcagggctcggacaccgcctggagggtcccgaatggtgcaaagcaagccgacagtgacatccctctagatcgcttgacaatatcttattgtcggagtagtggtcctggggggcagaatgtgaacaaagtgaattccaaggcagaagtcaggttccatttggcaactgccgagtggatcgcggagcccgtgcggcagaagatagccatcacgcataaaaacaagatcaacaggttaggagagttgatcctcacctctgagagcagccgctatcagttccggaatctggcagattgcctgcagaaaattcgagacatgatcactgaggccagccagacaccgaaggagccaacaaaagaagatgttaaacttcatagaatcaggatagaaaacatgaatcgggaaaggctgagacaaaagagaattcattctgctgtaaagacaagcaggagggtcgacatggactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 7 open reading frame 61
- chromosome 1 open reading frame 49
- chromosome 8 open reading frame 33
- ring finger protein, transmembrane 2

Buy ICT1-immature colon carcinoma transcript 1 Gene now

Add to cart