Login to display prices
Login to display prices
ICT1-immature colon carcinoma transcript 1 Gene View larger

ICT1-immature colon carcinoma transcript 1 Gene

PTXBC015335

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ICT1-immature colon carcinoma transcript 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ICT1-immature colon carcinoma transcript 1 Gene

Proteogenix catalog: PTXBC015335
Ncbi symbol: ICT1
Product name: ICT1-immature colon carcinoma transcript 1 Gene
Size: 2ug
Accessions: BC015335
Gene id: 3396
Gene description: immature colon carcinoma transcript 1
Synonyms: peptidyl-tRNA hydrolase ICT1, mitochondrial; ICT1; DS-1; DS1; MRP-L58; 39S ribosomal protein L58, mitochondrial; digestion substraction 1; immature colon carcinoma transcript 1 protein; mitochondrial ribosomal protein L58
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggccaccaggtgcctgcgctggggcctgagccgagccggagtctggctgctcccaccgcccgcacggtgcccacgccgggcgctgcacaagcagaaagacggcactgagttcaagagcatctacagcctggacaagctctaccccgaatctcagggctcggacaccgcctggagggtcccgaatggtgcaaagcaagccgacagtgacatccctctagatcgcttgacaatatcttattgtcggagtagtggtcctggggggcagaatgtgaacaaagtgaattccaaggcagaagtcaggttccatttggcaactgccgagtggatcgcggagcccgtgcggcagaagatagccatcacgcataaaaacaagatcaacaggttaggagagttgatcctcacctctgagagcagccgctatcagttccggaatctggcagattgcctgcagaaaattcgagacatgatcactgaggccagccagacaccgaaggagccaacaaaagaagatgttaaacttcatagaatcaggatagaaaacatgaatcgggaaaggctgagacaaaagagaattcattctgctgtaaagacaagcaggagggtcgacatggactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: