Login to display prices
Login to display prices
C1orf49-chromosome 1 open reading frame 49 Gene View larger

C1orf49-chromosome 1 open reading frame 49 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C1orf49-chromosome 1 open reading frame 49 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C1orf49-chromosome 1 open reading frame 49 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034972
Product type: DNA & cDNA
Ncbi symbol: C1orf49
Origin species: Human
Product name: C1orf49-chromosome 1 open reading frame 49 Gene
Size: 2ug
Accessions: BC034972
Gene id: 84066
Gene description: chromosome 1 open reading frame 49
Synonyms: C1orf49; TSC24; testis-expressed sequence 35 protein; Testis-Specific Conserved gene 24kDa; testis expressed 35
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcggccaagagggcagaattgaagaaaacacatctggtaaaagagagacattgctggacaagcaagaactacaaggcagtttgcctggaattgaagccagagccgaccaaaacatttgattacaaagcagttaaacaagaagggcggtttaccaaagcaggagtgacacaggacctaaagaatgaactcagggaagtgagagaagagctcaaggagaaaatggaggagataaaacagataaaggatctaatggacaaggattttgataaacttcacgaatttgtggaaattatgaaggaaatgcagaaagatatggatgagaagatggacattttaataaatacacagaagaactataagcttccccttagaagagcaccaaaggagcagcaggaactcaggctgatgggaaagactcacagagaaccacagctcaggcccaagaaaatggatggagccagtggagtcaatggagcaccctgtgctcttcacaagaagacgatggcaccacaaaaaacaaaacagggctcactggatccccttcatcactgtgggacctgctgcgagaaatgtttgttgtgtgctctaaagaacaactacaatcggggtatatacgctgcagtgggactgctggatctatggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 8 open reading frame 33
- ring finger protein, transmembrane 2
- solute carrier family 45, member 2
- chromosome 7 open reading frame 45