C7orf61-chromosome 7 open reading frame 61 Gene View larger

C7orf61-chromosome 7 open reading frame 61 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C7orf61-chromosome 7 open reading frame 61 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C7orf61-chromosome 7 open reading frame 61 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031966
Product type: DNA & cDNA
Ncbi symbol: C7orf61
Origin species: Human
Product name: C7orf61-chromosome 7 open reading frame 61 Gene
Size: 2ug
Accessions: BC031966
Gene id: 402573
Gene description: chromosome 7 open reading frame 61
Synonyms: uncharacterized protein C7orf61; chromosome 7 open reading frame 61
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggttgtggtcatgaagttcttccgatgggttagacgggcttggcaaaggattatttcctgggttttcttctggaggcaaaaaattaaaccaaccatctcaggacaccctgactccaagaaacactcattgaagaagatggagaagactctccaggtggttgagactttgaggttggtcgagctcccaaaagaggctaagcccaagttgggtgagtcccccgagctggcagatccctgcgtgttggccaagactacagaggagaccgaggtggagctgggccaacagggccaatccctactgcagctgccgaggacggccgtcaagtctgtctccacgctcatggtctctgccctgcagagcggctggcagatgtgcagctggaagtcatcagtgagttctgcctcagtcagctcccaagtgaggacgcagtcacctttgaagactccggaggctgagttgctgtgggaggtgtacctggtgctgtgggccgttcggaaacacctgcgccggctgtaccgcaggcaggagaggcacagacggcaccacgtccgatgccatgctgccccccgacccaacccggctcagtccctgaaactggatgcccaaagtcccctctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 1 open reading frame 49
- chromosome 8 open reading frame 33
- ring finger protein, transmembrane 2
- solute carrier family 45, member 2

Buy C7orf61-chromosome 7 open reading frame 61 Gene now

Add to cart