MRPL40-mitochondrial ribosomal protein L40 Gene View larger

MRPL40-mitochondrial ribosomal protein L40 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPL40-mitochondrial ribosomal protein L40 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MRPL40-mitochondrial ribosomal protein L40 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009707
Product type: DNA & cDNA
Ncbi symbol: MRPL40
Origin species: Human
Product name: MRPL40-mitochondrial ribosomal protein L40 Gene
Size: 2ug
Accessions: BC009707
Gene id: 64976
Gene description: mitochondrial ribosomal protein L40
Synonyms: L40mt; MRP-L22; MRP-L40; MRPL22; NLVCF; URIM; 39S ribosomal protein L40, mitochondrial; nuclear localization signal-containing protein deleted in velocardiofacial syndrome; up-regulated in metastasis; mitochondrial ribosomal protein L40
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacggcctccgtgctgcgaagtatctcgctagccctgcgcccgactagcgggcttctgggaacttggcagacgcagcttagagagactcaccagcgagcgtcattgttgtctttctgggaactcattcccatgagatcagaacctcttcgaaaaaagaagaaggtagatcctaaaaaagaccaagaagcaaaggagcgcttgaaaaggaagatccgaaaactggaaaaggctactcaagagctaattcctattgaagattttattacccctctaaagttcttggataaagcaagagagcggcctcaggtggagctcacctttgaggagactgagaggagagctctgcttctgaagaagtggtccttgtacaagcagcaagagcgtaagatggagagggacaccatcagggctatgctagaagcccagcaggaagctctggaggaactgcaactggaatccccgaagctccatgctgaggccatcaagcgggatcctaacctgttcccctttgagaaggaagggccacattacacaccaccgatccctaactaccaaccccctgaaggcaggtacaatgacatcaccaaggtgtacacacaagtggagtttaagagatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - immature colon carcinoma transcript 1
- chromosome 7 open reading frame 61
- chromosome 1 open reading frame 49
- chromosome 8 open reading frame 33

Buy MRPL40-mitochondrial ribosomal protein L40 Gene now

Add to cart