Login to display prices
Login to display prices
GOSR2-golgi SNAP receptor complex member 2 Gene View larger

GOSR2-golgi SNAP receptor complex member 2 Gene

PTXBC034762

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GOSR2-golgi SNAP receptor complex member 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GOSR2-golgi SNAP receptor complex member 2 Gene

Proteogenix catalog: PTXBC034762
Ncbi symbol: GOSR2
Product name: GOSR2-golgi SNAP receptor complex member 2 Gene
Size: 2ug
Accessions: BC034762
Gene id: 9570
Gene description: golgi SNAP receptor complex member 2
Synonyms: Bos1; EPM6; GS27; Golgi SNAP receptor complex member 2; 27 kDa Golgi SNARE protein; membrin
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatcccctgttccagcaaacgcacaagcaggtccacgagatccagtcttgcatgggacgcctggagacggcagacaagcagtctgtgcacatagtagaaaacgaaatccaagcaagcatagaccagatattcagccgtctagaacgtctggagattttgtccagcaaggagccccctaacaaaaggcaaaatgccagacttcgggttgaccagttaaagtatgatgtccagcacctgcagactgcgctcagaaacttccagcatcggcgccatgcaagggagcagcaggagagacagcgagaagagcttctgtctcgaaccttcaccactaacgactctgacaccaccataccaatggacgaatcactgcagtttaactcctccctccagaaagttcacaacggcatggatgacctcattttagatgggcacaatattttagatggactgaggacccagagactgaccttgaaggtggggtccctgctgggggacagagagaaggcctcttgttttagcctcatccaacagtttagtaactgtgtttatattttgattacgtgtcctcaaattgtgatattttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice